Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11191  (registered. 2012)
Contig Information
Length 842 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125558944|gb|EAZ04480.1|| hypothetical protein OsI_26629 [Oryza sativa Indica Group]
Score 168
Evalue 8.00E-40
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11191
ACTTGGGTGTACAGCTCGGAGATCTTCCCGCTGCACGTGCGCGCGCTGGGCTGCTCCCTCGGCGTGGCCGTCAACCGCCTGACCAGCGGCGTGATCTCCA
TGACCTTCATTTCGCTGTCCAAGGCCATGACCATCGGCGGCGCCTTCTTCCTCTTCGCCGGCATCGCCTCGTTCGCCTGGGTGTTCTTCTTCGCCTACCT
GCCGGAGACCCGCGGCCGCACGCTGGAGGACATGAGCTCGCTGTTCGGCCACACGGCCACGCACAAGCAGGGCGCCGCGGATGCCGACGACGACGCCGGG
AAGGAGAAGAAGGTGGAAATGGCCGCCACCAACTGAACGCAAGTTGGCAGATCGCGATGCGAAGACTTGCGCTGTATCCGTCCGTCTCGGCTAGCTAGCT
GCCACACTGCCACATAGATGACGAAGTAGCGTGGGAAGATTCGCTGATCCGGCCGGTGCTGCCGGAGAGCGACGGCAAGCTCCAGCTCGATCGAGACGTT
AATGGCTTCTTAAATGTGCTATAAGTTTAATTTTTCGTGATTTGGCTCGTTTTGTCCGGGTAGCAGGCTGTGAGCAATCCGACAGTGCCAATGCCAAGGC
TAATCGCCGCCGGACTAGACTACTGTAGTAGACTGTAGAGGTGTGCCCTAGCTACTTCCGTGGCGTTTGTCTCGTACTCGCGCTGCATGGGTCAAGTGCA
CGCGAGCTTTGGTTAGGAGAGAAAAACTGGCGGTGGTTCGAGGAATCTACCTGCCGATCGAGTGAGTCAGGCGAGCCACGGAAAATGTGTAAGAAAAAAC
TATCAGTATGTGTATTGTAAAGACGTGGGTGTAAAAAAAAAA
page-top