Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16752  (registered. 2007)
Contig Information
Length 932 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit tubulin folding cofactor A [Hordeum vulgare subsp. vulgare]
Score 402
Evalue 3.15229e-37
Total Hit Count 115
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16752
TTACAGTGCATTGTCGTTCTGAATCAGAGGGGGAAACTGCACAAATCTACGTCTTGCAGGAAATTTAAACAAGGCCCACAATGCGCCCTCCCTCGGGCTA
CATCAAAGCATGAAAGATTATGACCCCAATAACTAAAAACAAGCAGCAACAAGCCATATCATCCGAGACTCAAATGGAACAATGCCAACAACATGCAGCA
TTTCCAGCACATCATAAACGCCTAACCATATTCCAGTACAGTGATATTACCAGTTGCACATCTCGAGACAGATCATGAGTCGTGATACATACAAGCTTTC
GCGTCAACATCATATGAATGGGACTAACTTGTCGACAAGAGCAAGTCTGGTGATGCATACTGACATTTCAGCGAAAAGGAAGTTGCGAGCTTAATCTTCA
GCTTCTGTTGGCGTGTAGACAGCTTCAACTTCAGTGATTGTAGCCTCAGCCTCACCGATCTCAGTGCCTTGTTCATTTGACTCCTTCAACTCGGCCAGAG
TTGCTTTCAAGTCTGTCAGTGCAGCTTCAAGCCGCTTATGGCAGTCTGGGACCATCATCCTCGACTCAGCTAAAACATTTTCCTGCTGCTTGAGATCATA
GGGGTCGGCGCCCTTCTCCTTCATGTCGGCGGTCTTGGCGGCCTCCTTCTCCACCTCCTTCTCGTACGAGCGCAGCTCTTTGACGATCCTCTTGCACGTC
GACGTCTTGATCTTCAGGTTCCTCAGGGTCGCCATTCTGAGATGCGACCAGGGGCGGGATCTTGCTCTGGTTGCAGCGTGGCCGACGGGGAGGCAGCTGG
CACGGAGGCTTTACGGCGGTGGCGGTCCTCCTGTTCCGGTATGGGTCGGCGGCGGCGAGGCCGGGGAGGGAGAGGGGGGAGAGGCGGGGTGGCCGGAGAT
GGCGGCGGCGGCGGCTTGGTTCAGGGGGCAAA
page-top