Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1119  (registered. 2012)
Contig Information
Length 1557 bp
Clones alternative view 26 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_r Root 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 1
WH_XA Root 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|8928429|sp|Q9ZRB0.1|TBB3_WHEAT|TBB3_WHEAT RecName: Full=Tubulin beta-3 chain; AltName: Full=Beta-3-tubulin
Score 913
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1119
CCTCGCCGGAACCCTACCCCTCCCCCGTCGCCGCCATGAGGGAAATCCTCCACATCCAGGGCGGCCAGTGCGGCAACCAGATCGGGGCCAAGTTCTGGGA
GGTGATCTGCGACGAGCACGGCATCGACCAGACCGGCAAGTACGCCGGCGACTCCGACCTCCAGCTCGAGCGCATCAACGTCTACTACAACGAGGCCAGC
GGCGGCCGCTTCGTGCCCCGCGCCGTCCTCATGGACCTCGAGCCGGGGACCATGGACTCCCTCCGCTCGGGGCCCTACGGCCAGATCTTCCGCCCCGACA
ACTTCGTCTTCGGCCAGTCCGGCGCCGGCAACAACTGGGCCAAGGGCCACTACACCGAGGGCGCCGAGCTCATCGACTCCGTCCTCGACGTCGTCCGCAA
GGAGGCCGAGAACTGTGACTGCCTGCAAGGATTTCAAGTTTGCCACTCTCTGGGAGGAGGAACTGGTTCTGGTATGGGTACACTGCTCATCTCCAAGATC
AGGGAGGAGTACCCAGATAGGATGATGTTGACATTCTCAGTCTTCCCATCACCGAAGGTGTCTGACACTGTGGTGGAACCTTACAATGCTACGCTCTCTG
TACACCAACTTGTTGAGAATGCTGATGAGTGCATGGTGCTTGACAATGAGGCTCTCTACGACATCTGCTTCCGCACTCTGAAGCTTGCTACACCCACATT
TGGTGATCTGAACCATCTTATATCTGCAACAATGAGCGGTGTCACTTGCTGCCTCCGCTTCCCCGGTCAGCTGAACTCCGACCTCCGGAAACTCGCAGTC
AACTTGATCCCGTTCCCTCGCCTCCATTTCTTCATGGTTGGCTTTGCACCACTGACCTCAAGGGGTTCTCAGCAGTACCGTGCCCTCACTGTTCCTGAGT
TGACCCAGCAGATGTGGGACTCAAAGAACATGATGTGTGCTGCTGACCCGCGGCACGGCCGCTACCTCACAGCCTCTGCCATGTTCCGTGGGAAGATGAG
CACCAAGGAGGTTGACGAGCAGATGCTGAACGTCCAGAACAAGAACTCATCATACTTTGTGGAGTGGATACCCAACAATGTGAAGTCAAGCGTGTGTGAC
ATCCCTCCCACAGGCCTGTCAATGTCGTCCACCTTTGTCGGCAACTCCACCTCCATCCAGGAGATGTTCCGCCGTGTGAGCGAGCAGTTCACTGCCATGT
TCAGGAGGAAGGCTTTCTTGCACTGGTACACCGGGGAGGGCATGGATGAGATGGAGTTCACCGAGGCGGAGAGCAACATGAACGATCTGGTCGCTGAGTA
CCAGCAGTACCAGGATGCCACAGCCGACGAGGAGGAAGAGTATGACGAGGAGGAGGAAGAGGAGGCTGCCTAAGCCACCTGACCTCATATGGTCATCCTG
CTGTCTGTTAGATATGCCTTGTGTTTACTATTGCTGTCGATTTGGTGGTGCTTGTGGTGCGGATAGATCTTTAGGTGGTTGGTAACACTTATAGATGCTT
TTGCTGCTTCGGCGAATCGATATTTTTTGAACTGTTTTTTGGATGCTGATGGTGGTT
page-top