Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16746  (registered. 2007)
Contig Information
Length 1554 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_25805 [Oryza sativa Indica Group]
Score 719
Evalue 1.14454e-73
Total Hit Count 185
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16746
AATTTGAAGAGCGTCTTCGAAGCCATCCTACAGTGTGGGCACCACGACGATGTGGCTCAGCAGGCAGCCAAAAGTCCCTTGGACGTTGGCGGCGGCAGCA
GCAGCCATGCTGATGCGCAGCTGCAATGGCCTTGGAGACCATGTAACTGAACAAGAATACATCTCATCAAAAAGAAAAAAGAAGCGGCAGCTCCAAATTT
ACGTGTGGAATAGAATACTTATCTTTCCACACTCTGCTGTTATTACACAGCTAACTTTTCCCTCTCATCTACTAATTGTTACACATATAACAAGAATAAA
AAAAGATACAACAATCTCTCCAAACAAAACTAAGATCACAAATCGCAACGAGACGTAATTCCTTCCTGGCTCCGGCATGTGACTCTTGGCAAAACGGCAG
AACATCATCATCATCGTGAAAAGCCCACGTGGAGATTGGCACCTAAAACTGCATGCTCCTTGAAGGCATCGTCATCAATCACAGTAAAGCCTAACCACCG
AGTCGGCGCCAGCAGTGAACAGCCACGGTTGTCTTGGGTGGAATTTGCAATCCAAAACTCCTCTTCTATCTGAACTCAAATGGCCACGAAGAATCTCCAG
TGGCACAATAAGTGGGTTCTGGTTGAGATCAGCATAGACCATCCCATGGAACACATGAGCTGTACAATCCTCCGATGACGAGGCAAATTTGGTTTAGGTG
CAGGGATGTAGCTCAAGCCTTGCCGCTTATTGTCTGCTGTATCAGTGTCATCTCCCCACAAGAGGTAATAGTTTGGCTCATCCTTTGGCTTGTCAAACTT
GATCCATCCTTTACGAATGGCTCTAACGAGTTTAACAACCTTCTTTTGCTCCCACTTTGAGGGAACAAATCGCCTCTTTGGTTCAGGAGCGTTAGAAAGT
GGATGGCCTTTATCAGCATATTCAAACCAGTCAACATAATCTGGATAAGGATCAACATTGGCGTGTGGAGTCTTCCCCTTCATCAGTCTACTAATTATCT
TAGCTTCTTCCTTGGTAATCTTCACCTCCTCGCCATTATAGTCATCCCAAAGCTTTCTCCAGTCATCATCGTTATCTTTGCTGCTGAGGAAGCTGTCGAT
TTTGCCATCCCTGTCCCGCTTCTTGATCTTCCTCCCGGAGATGTCGTACCCGATGTGCTCCTCGTCCTTGTACCACTTAAGCGGCACGTCCCCGACGGTG
TTCCGCGGCGCAACCTCGTCCTCAGAGGAGTCGCTCTCTTCCGCCGCGGCGTCATCCTCCTCCTCCAGGCCGTCGGAGTCGACGTCAGAGCCCTCGCCGC
TGTCCTCGAACGACAGCGAGGCCTCGTCATCGTCTTCGTCCTCGGACCAGGCGCTGTCGCTCCACGGCGAATCGTCGGGGGAGAGATCGGCGGCGTCGTC
TCCGCCGGGGGAGAGCGCGGCCTTGTCTTCTCCGTCGACGCGCCCCATTCCGGACGGCGAGAGGCTGGGGGTTTGGGCGGCGCGGTGGTGGAGGGGGGAG
GCCGCCGCCTGGGCTGCTAGGGTTTTAGGAGGGGACGGACGGAGGGGAAAGAGT
page-top