Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16744  (registered. 2007)
Contig Information
Length 1101 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 3
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1155
Evalue 3.46178e-125
Total Hit Count 123
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16744
ATGTACAGCGGCAATGGTACAGAATATTTACATTGCGGCGTGGCGCACATGAGCAGCCGCGCTTTCGCGTGAACTATGCACCTCTCAGATGCAGCTTCAA
CATGATCACTTCCATGAGAACTAACTATGCACCTCTGAGTTCATGTGATTATGTGGACCACTCATTGCTCCTTTTGTGCCTCTGGGAACAACTGCAGCGC
TTGCGTCGTTAGTCGCTTCGCGACAAAGAACAAGGGTATTCTATTCAGTTTCCCTCCATGCAAAGATTTCAGTTCATCAATGGTTTGCTCTTCTTGTGTA
CCAGCAGCTGTCATGACAAACAGTGGGTATAGTATTGCCATCACACCATAACTTGTAAGAGGAGAGAAGAAGAAAATCGGAAGTACACATGGACTACCAA
ATCCGGCAAAGAAAGCCCAATTTGACTCAAAGAAATCAAGCCGGTGGTTCAGGCTCACTGCAAAGAAGTTCCACTTGTACTCGAAGCAGTAGTAGGCATA
CATCAAAGACAGTAACATGAAGTTCATTGCCTTACCAAGGTAAGGTATGCAACCAATCACTGTAACCTCAGCAAAGAAAATAGTCAAAAGAAGTATCGAA
TAGACCTGCTCTCCAACACCAATCGCAACCCCATCAAATCCTTCAGGCCTATCTGCTGATACAGATGTGCTGTGAGGGTCAGAGTCAGATGCTTGACTTG
CATCCAGCTTCTTACTTTTCACAACAGCCAAAGCATGCTTAGCAATGTCACCATACCAAAGTGTACTTATTATAAAGCTGAAGATGTAGAGGGGATAAAA
CCAAAATACATAGAAAATCTCGACAAGCCCCGAACGTAAGAACGAATACAAGGCAACAGCTGTTGTGTGATCACATAGATGTTGTCCCCATGATTGATCG
CATTGCTCGGGCAGTATCCATAGAAGAGTTGGAATGACCACCGATTTCAAGGTTAGCAAGCTCCCCAGGAAGATGAACCCGTTGAGCAGGAAGCACTGAG
CGATTCTGATCGACAGAGCCCTGGAGCTGACGCAGAAGGAGACGACCGCGGTGGAGACGCGCGGCCTGGAGGAAGCCGGCGAGCCAGAGCACGGCAGCCG
G
page-top