Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16686  (registered. 2007)
Contig Information
Length 293 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein BRAFLDRAFT_133850 [Branchiostoma floridae] >gi|210091621|gb|EEA39868.1| hypothetical protein BRAFLDRAFT_133850 [Branchiostoma floridae]
Score 65
Evalue 0.781671
Total Hit Count 5
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16686
GCGGAGCGAGCTGGATGCAATGCATCCTTGCTAATAACTAGTAGGTCCTATTTATCCAGACCTGATTCTTGTTGCTGACACCAACCCAACCCCCACCCCA
TCCCATTCATGTGTATATTTTCATGGAGCCGAGCATTGGTGGTCAGCAGCAGGAGGATCTGCTTGCTTAATTTTAATTTTAGTTTTAATTACTGCCGCAT
CGATTGTAGCGCGTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGGATGGTGAATGAATGAATGAATGAATTTCCTCCTTAAAAAAAAAA
page-top