Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16586  (registered. 2007)
Contig Information
Length 1421 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_017704 [Oryza sativa (japonica cultivar-group)]
Score 1086
Evalue 2.83187e-116
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16586
TTTTTTTTTTGAATAACTGGAACCTAAGTTTTCTTATCAGTAAGTAGCATAATAGGCAAGCAGCTTCTAGGAGGGAAAGAGCATCCAGACTGATGCCAAA
GGCTAATCCAACCAACCAACCCGTCAGGGTATAAAATTATACACAACCCTCAAAGTAGACATTTATCATCGCCAAGAGAACCCTAACACAAGTTACAAGT
CCTCTTATCAACACAAGTTCCCAGCCCCAGCCAGCCATGGTTGGTCTTCTCCGAGGAAGCAAAAGTACCACCACATTCCTTCAGCATCCCGGTTCCGCAC
CGCTGTCGCAACATTCCGAACCGATCTTCTTCACCTTAGAGGACAGACATTCTCCTCTTGCCGTTGAACACCCGCTGCGCATTGCCAAATCTCCCAGCCA
TTATTTGTTCACGCAGAGCTGGATCAAAGATGCCAGTACCAGACGTCATGGAAGTCGTTCTTGCTGGAGCAGGTGAACCAAGAGCGACTCTTTTCTGGAT
GCTGAAGCATAGCTTGCTGGCATTTCCAGAGCCCGACTGCATCCTCAACCTCTGCTGTGGAGACGAGATATTGTTCCTTGACTTCCGCATGGACAGCGTT
GGAGGGCTTGAGAACCTGCTGCTGCTGCCGAACTCCATTCTTCTAAACTTCCCTCTGACATCTGGAGTTGCGTCGACTGCTGCTTGTGGTGTTTCTGGAA
TTGAGTTAAAAGCCTGTGGTCTTGCTGTTCTTGACATTTGGACATGGGACAGTCGTGACATCGCCTTCTTCTCGGGAAATATGGACATCCGCTCTCTCTC
GCTTGGTAGGATTGCGATCGAGGATCGCCTCTTAGGCTGGAGAGGGATCTGTCGCATCATGGGAACTAAAGATACACGCCGCGCTTTGCCAGCAGTCTTG
TCCACAGTTGTTTTGTTCGTCGTAGGGATGTTCTCTTTGTTCTGAACTGAAGATCCCTTACCAGCGAACCTCAGTCTGGAAGGGCCTGAAGGTTGTGGCA
TGTTGTTGCTTGGTGGTCTCTGCCTCATAGGAGCAAGTGGTGGTCTCTGCCTCACAGGAGCTGCAAATGATGGCTTCGCCGATTTACCCGTATCCCTCGC
AGCCTTCTTCTCATTAGCTAATTCATTCTCCAGCTCTCTAGCCCGCTGCTGATGAGTTCTGCAGGCTTGCTCAGTCTCCCTTATCTTATCTTGAAGAGTT
CTGAAGACATTCTCACGAGAAGCATACTTGAGTTGCATCAGTTGCAAGCTTTCGTTCAACTTCGCATTTTCCTTTTCCTCATGGCAGAGCTTTTCGGCCA
TCTGCTTGATCTTGAAGTTTTCAGCTGGATCCACTTGTTTACGAGCAGGGCCATGTTCAATAGCTCGAACTCTACTAGCAAAATTTAGCGAGCATAAAGT
TTCTCCTGAATCTGTAGAGCT
page-top