Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16561  (registered. 2007)
Contig Information
Length 789 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative alanine aminotransferase [Triticum aestivum]
Score 381
Evalue 6.40114e-35
Total Hit Count 307
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16561
AACGTGCATTTACAGGGTTTTAAAGTAATAACCAAAAAAGGTTTTAAAGTATGCCCGTTGATGTGTTCCTTTCATAAGGATGGCTCCTTGGGTGGGCTGC
TGGAGATCGTCTTATGTAAACTGACAGGCCCGCTGACCAAACACCTACTATCCGTTCTGATTTTACAACATACGTGCAGTATGTCTTTTACAAGTAAGAT
GGTCCAGGAACAGAACAAACTCAACCTCCGATCACAGAACTGAAAACATCTACTACACAGTAAGATTTCCCCCCATAACATTACTCAAGGTTTAGTAAAA
TCTTGCACCCCCCAGGCCCTAAGAACAAGGCAAGCAGCGCATGGTTTTGCAAATATACAATTCTCGAGATTTTGTAAGGTTTACTTCAGGGGCTACATGT
AAAACAAGCCTGCACGAGTTAGGTTGATTCATCCATTGAACGGGGGTAGCACAACTGCATGACCTTCATTATTTCGACCGAAAAGGCAATTATATCCAAA
GTTTGAATTGCCCGTTTAATCTCCTCTGCTTTCAATCGTAGTACCGGTGGGTGCTTCATCACGGCTAACATCACGGAATTCGTCCATGAATTTCTCATGG
AATTCCTTGAATCTGGATATGATTGCAGGGATTTTGTCCTCCTGAGGCAAGATCGTGCATCTGAAGTGATACGTTCCAGGAGCCTGACCAAATCCAGATC
CAGGAACGACGACAATTCCAGTGGCTTGAAGAAGGCGGAGAGCATAGTATGCATCTGGGGCAGCACCAGCTGCTTGGGCAGCCCCAATC
page-top