Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16527  (registered. 2007)
Contig Information
Length 628 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit early nodulin protein [Brachypodium sylvaticum]
Score 360
Evalue 1.0879e-32
Total Hit Count 51
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16527
TTTTTTTTTTGCAAATGCAAGTTATTATTAGTTCAAGATTACTGGCTGGATACATGATGATTACTTGATCAGACAAGTCCTTGCACGCAGAGAAGAGCAG
TACACCACACCACTGACTGTCTGCAAGCCTCGGGTAAGTGCTGAACGTTACACACCATCTTTCAGCAGACACGTACGGGCTGGCGCACACAGCTTATCGC
GCACTGCTAATGGATCTGTTATTACAGTCTAATTAGTGGAAGGAGGTGTTCTTGAGGTGCTCTGGCGCGTCGTCGAAGGAGTGCTTCCTGGCCATGGAGA
GGATGGTCTTGTCGGCGACGATGAAGTAGGCCATCCCGGCGACGGTGGAGATGATGAGCGCCTGCCCGGTTGGGTTGAGGTGCGCCCTCGCCCACGGCAG
CATCCTCACGCTCGCCAGGGTGGGGATTGCGGCGGCGACGGTGGCGACGGCCGCGGCCTTGGCTCCCGCCATGGCGGCCTCTCTGGAGGAGCGCTTGGCG
GCGGCGAGCCTCTGGTCGAGGTAGGCAGGGGTCACCGTCGACATCTTCGCGGGAGAGAGCTCGGTGGCACGAGAACCCAAGGAAGTGAATTACTAGTAGC
TAGCAGTGAAGTGTGTGAGGCAAGATGA
page-top