Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16524  (registered. 2007)
Contig Information
Length 748 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_05804 [Oryza sativa Indica Group]
Score 272
Evalue 2.51057e-22
Total Hit Count 217
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16524
TTTTTTTTTTGAAGATAATATCATCTTATCTTTCTTCTCAGAGAGTTTAACACATTATTGTTGGGAGAAAATACATATAGAAAAAGAGTAGAGCCCAGAG
CCAATGTACGTAGCATTTAAATGGCGTGTCGCAGCACCCATGGTCAAGCTAGTTTTAGGAGAATTATAACCCTCACGGCAAATGTCGCAGCACGCGTGAT
CAAGCTAGTCTTAGGAGAATTTTAGCCCTCACAACAATAAGCTCACACATATACACTATATTCTTCACTGCATTGATTTTGTAGGCTACAGCCTTGATGC
TAAACCACCACCCAGCTTCTGCAGACACTTCTGGTCAACCTCTTGAGGTGACATGATCAGAATGGACTTGATGCTGATCACAAACTCCTCCCATGGGCCA
TCACCGAGAAGTAGGAAGTCACCCTCATCATCCTGGTAGAGACACGTCCAACCTTTAGTCTGTCGTTCTTCGAGTTGCCCTTCGATACCAAACATGTGGG
CCAAAGCTTGATTCAATTCTCCGTATCCAGAGAACCTACCGATGTCAATGGAGCGGCTTATAACCCCACGTTTGTGCACCTTAATGAATGGCATCCTCTG
GCGAAGGGGCAAGGCACCAAGAATTTCTGACCACGGGCGGGCGGAGATTCGGCTGCCGAGCAGAACAGAGCAGAAGGCGGCCTCGTGCCGAATTCGGCAC
GAGGGACCCATCTGTTAAAGTTCCTGTTAAAATTGATTTCAAGAAGAT
page-top