Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16475  (registered. 2007)
Contig Information
Length 868 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_33485 [Oryza sativa Indica Group]
Score 901
Evalue 3.78684e-95
Total Hit Count 61
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16475
TTTTTTTTTTCAAAGCAACCGAGACCATTAACGATGACTACGGAGTACAAGCATAGAAATCTTTTAAACAGGGGTGAACAAAGTCATCAATTATTACACG
CTTCCTCCAAACCTCAAGAGCATCAAAAAGAGAATCGTTCCGCGGAATAACGATGCATAGTTCAGACCATTTCCGACAGTATGTGCCGATATCTGCTATA
GTCCGACGTCGTCTTGAAACTCGGCGTGAGCTCAGCAAAAAAGCTCAGCACAGCGGCAAGGTTCGGCGTGATGTTCTTGGCCACGGCTTCCTCCAAGAAC
AGGGAAGGCTGCACGGTGATAACCTTGTATTTTCGAGCATAGCGTAGAGCCTCCAGGTAGTACCCGTCTTGGAGTAATGCAGCCACGTAGTCATGGTGCA
GGCACCTCTCCCGGAGCATGTCCACTCCCAGCTTCCTTGTCAGCGAATGATGTCGACCCAGATCAATGAGCTGCATTGCGAGTTCCCTGGACGGCTCTAG
AATCTTGTTCGATACAAACAGTGCTATTTCAGCATAACGGTTGCTGCAGGCCAGCAAAGCAGTCATCATGACATAAAGGTCAGGAGGAGCCTTCAGCCCA
GCTTTTGACAGGCTTCGTAAAAACTCCATGATGACAGCAATAAGGTATGCAGGATCACCCATCATTTCATCTTCAACAAGCACAAAGACGGACTGGACCA
TTTCAATTGGTGAAATTGCCACACTAGCAACATGTGTTCCATGCTGCATTGATGTACCAGAAGCCAATGGTTGGCTATCCTCTCCTACAACCTGCGGTCT
TTTGCCAGTGGCGTCAGATATCTGGGAACTTGATGTTGCCTGACTTACNGCTCTCGATGTATTGGTAA
page-top