Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16419  (registered. 2007)
Contig Information
Length 605 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 1
Wh_SHC Shoot grown with cold treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative cytosolic aldehyde dehydrogenase [Oryza sativa Japonica Group] >gi|125597735|gb|EAZ37515.1| hypothetical protein OsJ_020998 [Oryza sativa (japonica cultivar-group)]
Score 700
Evalue 3.74612e-72
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16419
ATCACACTCCGCGAGAGCCGACACCGGGTCTGGGAGAAGAGAGCAAGAGGCCATGGCGAGCGAGCGCAATGGCGACGGGGGCAAGGCGCGCGCCGCGGAG
AACGGCAACGGCGGCGGCAGCGGCGTGCCCATGGAGATGCCGGAGATCAGGCACACCAAGCTCTTCATCAACGGGGCCTTCGTCGACGCCGTCTCCGGTA
AGACATTCGAGACCAGGGATCCGCGTACCGGGGATGTGATCGCCAGCATCGCCGAAGGTGACAAGAAGGACGTGGACCTGGCGGTCAAGGCGGCAAGAGA
AGCCTTCGATCATGGCAAATGGCCTCGCATGCCCGGATCCGAAAGAGGAAGAATCATGATGAAGTACGCGGACCTGGTGGAGGGGCACGCGGACGAGCTG
ACTCTGCTGGAGAGCCTGGACGCCGGCAAGCCGTGCACCGTCACCAGGGCGGTCGACATGGCGACCGCCGTGAGGTCCCTGCGCTACTTCGCGGGTGCGG
CCGACAAGATCCACGGCGAGACGCTCAAGATGTCNAGGCAGTTCCAGGGGCACACCCTGCGCGAGCCCATGGGCGTCGCCGGGCTCATCATCCCCTGGAA
CTTCC
page-top