Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16375  (registered. 2007)
Contig Information
Length 1916 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit DEAD box RNA helicase1 [Zea mays] >gi|39653663|gb|AAR29370.1| DEAD box RNA helicase [Zea mays]
Score 232
Evalue 4.40934e-17
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16375
GAGCGTAAGCAATTGGCAGTGTTACCAGGGACTTCAGTTTCCATCTATCATGGTGACTAAGTTGTCTACGATTTAGAGACCTGAGACCTGTGGGCTTTGC
ATTCGAGGGAGATCCTTAACTTGCTCTTAAAAAGGGCAATATACTATTTAGCTTCTGTTAGTTGATTTCTTTAGCACCTTCGCTTGAGCATCAATTATTT
AATATGCATCTTAATGGTTTTCCAACTATCCCTGTAAGACATCTTCTGTAAGCATTGCTAAATATTTGTTGCTGTCTTCTTCGGTAAGTACCATCCTTCA
CATTCCTCACTATAAAAAACTGTACCATCTTGGGTAACTGCCAGTAGTCCATGTTTTGCTTCTTAACATCTTCCATTGCATTGATTTCTTGAGATAGTAT
TGCTAATAATTCTGCATGCACATATACCAACATGCCTAGTTATGCATATTGCACTCCCAATGCATCATATCTTAAGTTATACTACCTCCGTACCAAAATA
TAAGATGTTTTTAATGGCTAAACTAGCCTACAAAAACGTCTTATATTTTGATACAGAGCTTGTATCATCATATACATTAAATATGTGTTTAGGTACAACT
TCTCTAATGTTTTGTATCTTAGTGTTGTATTTAGAAGTGCTCTCATTTAATATGTTTTGTTAGACAAAAAGTATTAGTTGCCATGGTTTCAGTGATATGA
GCTATATCTAGAGTAAGACAAGTTAAAACTCTCTCCATGGAGCACTGTGACCGCCCTTGTTGGTCTAAAGCAATAAAAGCGCTCACACAGTGTGACTTGC
ATAGGTAATCAAGATAATTTGTTCTTCTTATAGAACTGTAAGGATCTCCCTGCCCCCTATACTTATTACCTGCTTAATAAGTGCCTCCCTTGTCTGTCGG
TATCACTGCCAATTGGTATAAAGATGGTTTGTAGTATTGTCATTGAAATCCTCAAGTTGACCTCTGATGAAGCACCTAAGCATTGCGGCCTGTGTTGGAT
TGGTGTGGACGACAGATTTGTTCTGGTTCACACGGATATATGTTGGTGTTGGTACATTATTGGATAATAGAAGTCACACGCTCTGTAAAAAAGGCTTGAG
AGTTTAAGCACCATCAATTCCACATCCAGCAGTGATTGATACCCAGTTCAGTTCTGCAGCCCCTTCGACTTGTGTTAGCTGTAGATGTTGAAAGTGAAGC
CTTGTGCAGTGTTCTTTGGATCTTGTCTAAGCCATGTGCTACCTTTCTGTGGAGATCGACAATGTTGATGCCCAGTGTGGTCCGCAGTGGTATTCAGGAA
TCAGGACTACACATTTATCTTGTTTGTATACTGATGATGGTCTTGTTGACTTTGCAGATGTGAAGGATATTAAGTGCGTGATTAATTTTGATTTCCCGAC
AACTATCGAGGATTATATTCACAGGATAGGCCGAACTGGCCGTGCTGGTGCTACCGGGATGGCATTTACGTTCTTCACACATTCCAATGCAAAATATTCA
AGGAATCTCGTTAAGATCTTGCGCGAAGCTGGGCAGGTTGTGAATCCAGCGCTAGAAGCTATGTCCAAGTCCTCTGGTTCTATGGGAGGAGGAGGCAATT
TCCGGTCAAGAGGCCGAGGTGGGTTTGGTGGTGGGTATGGTGGTAACCGTTCTGGATCAAATTCCATTCCAGTACGTAGAAGATACTAAGAAACGAAAAT
GAAGATCCATTTTGATGCTGGAAAAGACGGAACGATGAAGTTTTATCTGTATACATTAGGCATTAAATTAAATGCATTTTTGGGGAATTTCTTTGAAATC
CTGCTACTGTTAGAGATCAAAACAAAAGTCATTCTTAATATTTTTGTACCGGAGCTCATATGAAAGAATCTCATGTATCAGCGACCTTGGAGATTACAGT
AGTTCTATCGAAACAG
page-top