Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16373  (registered. 2007)
Contig Information
Length 1177 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Oryza sativa Japonica Group]
Score 448
Evalue 2.08644e-42
Total Hit Count 294
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16373
ATTCATGGAGGAAACATGTTTAGGCAAGAGCGCAGCACATTGGTCAACAGAACTGATGATTTTTACAACACAAATCTCTCGTTAGGAAGGCCAAGCAGTT
TCCGTGGAAAAGAAAATGTACCACCAAAGAGGATTGTCCAACCAAGCAGGTACCGTAGCTCACTATACGGCTGCAGTGAGAGGGGCCAAATAATGCCACA
TGAGAGAAAGATGTATGAGAACATAACATCCTTGGCCAATGTTGAAGGATCCAAACCTGCAGTTTTGATTGACAAAACCATCGCCACATTTGGACAGTTG
GGTAACTCGAAGAAAATAGGTGGCCGGGTCCAGGCCTATGTCATAAATGTGTACTGCAGGCACCTATTTAATGAAAATCATCCTAGGAACTCACTCAAGC
ACTATTTCTTCCATACTGCATCTGAATATTTCCTGGGCAAATGGAAAAATGATGAGGCAAGAATTTGGTGGAGGAAGAAACTGATTAGAAGTTTCATTGG
AGCTGGAAAAGCACATAATCTTTTGATGTCAGACAAGTTGTACTTTCCAACACTACACGAGGAATATTACTTTCTGTTCGTCGTCGACATCAAGGGTCGC
ACATTTTATTTTTTGGATTCTTTCTATGATGAGAATAGCTCATATCATATGAACATAAAAAAGAAGATTATCTCAAGCTTTATATGCACTTGGTACGAAG
CTCGGCTCCAGCCAATGGATTTCAGTGCATTCCCTACTGTTTACCCTAAAGTCCCTCAACAAGATAACGATATTGATTGTGGCATTTTCACTATGAAACT
AATGGGATGGTGCCCAAGGAATCCAACCCCTATAGTTTTTTCACCAAAAAATGTCCCAGATGCAAGGATCCGATATGCTGTTGATCTCATGTTCAGCCAC
TACAACACTTTGGATGACGAGAAGAAGCGTGTCAAGGAGTTCCGCCTATAGACATGAAAAAGTGCTGACAGCTCCTAAAAGACACCACTCACAATGACAA
GAGGAGCTATATCAAGAGTCATATTAGCAAAATCAAAGGAAAGATGAGATGTATCAAACACATAGTTAGCAATTGTTAAACATTTTCGAGATGTTTTTCT
ATTTTTTGTATGAACAGAGAATGTACACCTTTCTTGTTGCTGTACGCATATATATGCCCCCTCTGTTAAAAAAAAAA
page-top