Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11131  (registered. 2012)
Contig Information
Length 970 bp
Clones alternative view 28 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 4
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|116310796|emb|CAH67587.1|| OSIGBa0112M24.4 [Oryza sativa (indica cultivar-group)]
Score 376
Evalue 2.00E-102
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11131
AGCGATCCGCACTGAGAATTGTAACCAGGATCGTAGCACCATGCGGCAAAACTTCGCAAACACCAACTGTTATGTACAGGAGCCATTACATTTTACATAC
CATCCCAGATGCGGAGGAAGCACGACGCATTTACAGTTGTTTCTTCGCATCAGCTTTAATGGGCACACCGTAGACGACATAAACAGCAGTTCAGTCTATC
ATCAGATCAATCCCTCGCGTGACTCACAAGACTATGTATGTACAGACGCGCAGGCACGTTCTGCCCGCTCTACTCGTAGTGGCTATCTACAGATGGACGG
AGGTGCCGATTACCGGACTACTCCGGCCGCACGCTTACCAGGTTGGGGAGGGCGGCCAGCTGAAGCTTCTTGATCTCGCAGGCCGTCACCTTGCACGAGT
CGAGCGACAGCGAGCGCAGGTTCTGCAGCGGCCTCAGATGGTGGAGGCCGGCGTTGGATACCCGGGAGCTCGACAGGTTCAGCGAGACCAAAGCGGTCAG
GCCCGAGATTATCTCCAAGGTCTTGTCTGTGAGGTTGCCGTTTTGGGATAGGTTAAGCAACGTCAGGTCTTTGAGGTCCTTGATGTTCTTCACTCCAGCG
TCGGTGATTAGCCCACCGCAGAGCTCCAGAGACCGCAGACCCTTGAAACATCTGAGGCAGTTTGTCCCAGCATCAGTTATACGAGCTCCAAAAAGATCAA
GGTGCGTTAATCCGGTCAGAGTTGTAAGAGCTGCCAAGCCATTGTCTGTGATTTGGCGATTATCAAGATTAAGTGACCTCAGTGAATTCATGCCAGCAAT
TTTCTTCAGACCAATGTCCGTAATCACTGTAAAAGAGAGATTCATGCTATGCAAATTCCGAAGACCAGAGAGATGACGAAGTCCATTGCTTCCAACTGCA
GTGTCCGAAAGTTCCAAACTTCTTAACTGCAAAAGGCCTTTCAGGTGCAATAGTCCCTCGTCACCAATCT
page-top