Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1113  (registered. 2012)
Contig Information
Length 801 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 1
Wh_yd Spikelet at late flowering 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_PCDAM Anther at meiosis 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|166210345|gb|ABY85265.1|| homeobox-like resistance [Triticum aestivum]
Score 411
Evalue 4.00E-113
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1113
GATATAGCTATATAGATATCGACAATCCAACACTTTGTACACACACCAGCAAACAAGCCGACATCGGTACATTACAGTTACCGGGCGACCATCCTTCCTT
GATCGGAAGTTCCCAAGCAAACATTTTTTTGGACTTAATAAGTTCACAACGGAGCGCACAGGGAAGCGAAACAACTATGCTCCCACGTTCATCTTGTCGT
CATGTGCTTCATTTGCGGCTTCAACTTTTGGAATAACCTCCACGCTCCCCATCTGCACATCTGAAACTGAATCACCGTGGGTGCCAGCAGGCGCAGCTGG
CAAGGGAGCAGCCGGCTTGTCAGATGGCCCTCCTTGATCTGGGTTGCGGACCACGGTCACCTCGGCAGTGTTCACATCCATCATCTTGTGTGCCTTTTGG
GGTTTCTGCTCAACTGGGCTAACATTCTGAGCATCTGCAGATGCCGCCGCTCTAGATGCGTGCAAGATCTGGAGCCTGAAATCAGTTTCTGGTCGACGGC
ATACCTTCCTCAGAGGAACAATCTCCTCAGAGTGATCATGATCATAACGAACAAGAAACCTGCAGCGGCACCCTCTTACATCATGCCTGCGCCTTTGAGC
ATCAAGAACACGAGCGTCAAAATAGAGGGCCTGCTCTTTGCCTTCCTGAAAACAAAGAATGAGATCCCCAGGAAGCACAGCAACACATTCTGCAGCTTCA
CATGGAAGAGAACGCAGCCTCACACATTTACGAACATTAATCCATTCATCCTCCTCGGGCCCAAATCCAGAAAATCGAACTTTTACTTCCGGATCCCCTG
T
page-top