Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16142  (registered. 2007)
Contig Information
Length 835 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_PCDAM Anther at meiosis 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit integral membrane family protein-like [Oryza sativa Japonica Group] >gi|125554646|gb|EAZ00252.1| hypothetical protein OsI_22263 [Oryza sativa Indica Group] >gi|125596586|gb|EAZ36366.1| hypothetical protein OsJ_019849 [Oryza sativa (japonica cultivar-group)]
Score 571
Evalue 6.60499e-57
Total Hit Count 102
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16142
TTTTTTTTTTACTCAATCCATGACATTTATATTTCTGTAAAAACTGTATAAGTACAAAGGCCGATACAAAAGAAGTAACACCGTCAAGGCAGTGCACAAT
ATAGAAGATGGTAGCAAGAGAATAGGCCCACACATTATTACATGAAGGAAGCAAGTACAAGAACCACCCTCACACATATTTTTTTGTGCTGGGATATCAC
ACTTATACTTCAGGGAGCAAATGATGGATAATTCGGTCTAGCGCCTGGCTAGGGCCATGGCTGAGAGTAAGATGAGCAGTATCAGCAGAACCATGGCTCC
AAACGAGCCAACCAGGGAGCCAGAGGTACGCTCGCAGAAAGAATCCAACTGCTGGCATATAGCAAGCCAGTTTGCCCTGACATTACCCTTGTGTGCTAAG
TAGACAATAGCTGTTGCTGCAGATGACGCTGCGGTCACCAGAGCTAGCATTGCCGCGTCGAAAATGATCAAGACCAGCCTGCTATATTTAGCCCCGCTCC
TAATTATGTGCGCAATTGACAGTGGGAGCGAAAGGATGAGATAGGCGCTCACAATAGAATTTGCCACCACGAAGAACGTGAGAGCCGGGAGATCGCTGTA
TCGGGCCTTGAACTGGATGAATGGCGTGAACAGAGGAAGCGTCTCATTGGTAGTCCCCATGGCAATGGCGCTCGCGAGGGTGCTGATGACGGCAATGACG
CGAAGTATGAGGTCCAGTATGGACACTCCTCTACTTACCCCCTTGTTCAGGGGGGCCTTGGAGGTCTCACCCTGCTCGCCGGAGTCCATTCTGGTATTTT
TCTTAAGCTGCTGAACTGATCAAAACTCAAAACTG
page-top