Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16140  (registered. 2007)
Contig Information
Length 565 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Postia placenta Mad-698-R]
Score 79
Evalue 3.21113
Total Hit Count 3
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16140
GGCTCGAATACATCAGCTCGAATAGAAACGAGTCAGCGGAAGCAACAATATCTGAGTACAGACATAAGTTAAACAAGTTTGCCTTAAGAAGGCTAGCACA
AAAGCAACATCGACCGAAAAGGCAAGGCCTCCTGCCTGGGAGCCTCCTAACTACTCCTGGTCATCCGCGGTCTCCGTCACGTGGTAGTAGGCACCCTCGG
GGTAGTAGCAGTCGTCAAAGGTGTCATCTGGCTCCTGGATTCCGTCATCTGGTTGCTTTGGCAAGGAGGGGTCGTCAACACCGTAGTCGTACTGGGTTTC
GCCGGCAGTCTCGGGGTGTTGAGCCTGTAGATGAGCAGAGCGGGCTCGGGGAGGCTCCAGCGAGGCCGAATCGAAGACGACGAGCGGCGAGATGCAGAGG
CGGAGATGAGCTCGATGGTGACGCGCGAGGCCCTCCCAGCTTGCTCCGATGGTTGGAGTCGACGGAGAAGAGGACGGCGGTGCCTCTAGGCATCTTGTCG
TAGCTCGGGGATGACCATGGCCACGGAGACCACGACGGCACGGCGACGGCTTCGCTCGGGGTTTG
page-top