Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16134  (registered. 2007)
Contig Information
Length 908 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 3
Wh_VHS Shoot with heat shock treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_05843 [Oryza sativa Indica Group]
Score 725
Evalue 1.05787e-74
Total Hit Count 162
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16134
CGAAAGGTGCAAAACAACGCAAGCTATGCAAGCATTCTAGACATAGTCATGCCACAGCACACATAGTACAGAGCTTGATGGTTTACAGCGTTACAAAACA
TCGCTAAAACAGAGTTTCGACAGCAGAGGCTGGCCATCATAACCAAATATACATGATAAATAAGATGACATTGATGCTACTATGATCTTATTGTCTTCAC
TACTAACGACTTGATTTCACATACTATCATCTGCGACGAAATTAACATGATGTTTTGCCCTTACGTCGCCTGGTCGCAGATCCAGATAAGAAGACTCGTC
ACTCCTCAGCGTAAAACTTGGGAGAGAAATACCCTGGACATAAGATACTCCTCAAAATGTGAAGTCTCCACAAAGCAGGATATGTAAATATTGATCACAC
GAACATGGCTAGCTCTGGACGGCTGAAGATATTGTCTCCATCATCGCCCAGTGCAGGATAAGAAGCAACAAGTGCATCTTGTGCACCAATATACAGAGAG
TTATAGATCTTCCAATATACTTCACGTACTTTCCTTGCTGGATGGAAAAGGCCTTGGAGGCAATAATTCAGAACCACAGCTGCACCTAGAGCAACTCGCA
TCCCCTCAATAGCCTCCATGACGGCATTTATAACATGGGGAGATGTCTCGAATATGTTGGGCCAGATATAGTTAAGCAAATGGACAAGAGCATCCTCACA
ACCCAAGCCAGCAACTCCCAGAGCCATATGCTTAACAGCAGATGCAGCAGTCTGCCTGTGAACCAGGTCCCTGTCCATTAGGGCATCTTCGAGCAAGGGA
GTAACAGCATATATGTAATCTTTGCCCCATCTCACCCAATATACTCAAAGAGGNAAGAGAGAGACTTCNAAACACCATTCTGAACATTTTANCTCCGGNA
ACTCGGTA
page-top