Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig16064  (registered. 2007)
Contig Information
Length 796 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 3
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_16082 [Oryza sativa Indica Group]
Score 893
Evalue 2.79494e-94
Total Hit Count 450
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig16064
GGAGTAAAATGGAAGGAGAACCAATAGCTCCCATTACCATCTCACTTATGTAATTTTTTATACTGTCATCTATAGAGGGGCATGCTATATTCACAACTCA
CAAGCTTTTCAGATCTTACAAGAATAAATGATGCTTCCGCAACAATCAATTCCACCTTCATGTGATCCTATAATGACATTATTACATGGTGTCTGCATAA
CTGCGCACAGCATTCGCCAAATCCTGAACATGCTGATCCACAATACCTATTTTGTTTAACGCGTCCTCAAGTTTGAACAGATACTCTTTATTAGGTCCAG
TTGGGCCTTCAGCTAGGTAGATTTGCTTGGCCATTTCTTCTAGCGGAGCGGGACCCAGATAGTTTCGGTTGGCTTCCTTATTTGTGGTGGCTAAATATAT
CATCATATCTTGGACTGCTGGTATTTTGAGGGAAGAGTCTGTATACAAGTCAAGGTAAACCTTCTCATCATATTGCTTCTCTCTTACTTCCAGATACTCC
AGGGCTGTCTGCTTATCTTGCTCCCTTGAAATTTTGTAAGCAACTCCCCAGCATGTGGACCCGGGCTGGTGTTCCAGCGTGACGGTCCTGCCGGGGAACT
CCGGCGTGCCCCTGTGGTCCGTGCTCCCCTGGTAGAAGACGCGGCGGTAGTCCCTGACGAAGCCGACGAGGCGGGCGTCGTAGGCGAACCCGGGGTTCCA
CACCAGGGAGCCGTAGCCGAACACCCACATCACCATGCCTGCCCCTCCCCTCACTTGCTCCCAATCGGCGTGCGTGTGGGTTTGCCTCTGCCGCTT
page-top