Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11113  (registered. 2012)
Contig Information
Length 1176 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222625458|gb|EEE59590.1|| hypothetical protein OsJ_11898 [Oryza sativa Japonica Group]
Score 526
Evalue 3.00E-147
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11113
ACATTATTAGTCCTGTTAGTAAATGAACACTAATGTAATAAGAAGGCTACTCATGCCTCACCCAGAAATTCATGCAACTGTCTTCATACAAACATCGTTC
GAGTTGAGCTCTTAAAAGCCAAGACTGTCAAAAGATGATGTTACAACACATTATTAGTCCTGTTAGTAAATGAATACTAATGTAATAAAGAACCTAAGTA
ACTTCATGTCTGGGTCTGGTATCTGACGGTATCCAGGACACAATCAGAAGGATGATCGCTCTTCAAAATGCCTAGCCATCAGAACCAAAATCCATATCAG
AAGAGCTATACTCATTCTTAAGTTCCGCAACAAGGTACCCCGGAAAACAGTTCCAGTCAGGCACCCGAATACAACACTCAAGCTCAACGGTGCTTATCCC
TCGCACCCTTGACCTCATGGGTGAGCATCCTGGGAGCAATCGCCATCGCCATGAGCTCCTGGAAGAGGAGCTTACATGCGTACGGTATATGGACCTGGAC
AATGTCAGTTTTGTTCTTGCAGCCTCTGCATTCGAAGGAATTCTTCTTGAGATTGGCAATGGCAATGAGTCCACACTTCTCACAAACATGCACTCTGTAA
GCATCGCTCTGGTCAAATAACCTTTCCTTCAAGAAAAATGCAGCTCCATGAGCAATCATGCAATCCCTCTCCATTTCTCCAAAACGGAGACCACCATCAC
GTGAGCGCCCCTCTGCTGGCTGTCTGGTCAGTATCTGGACAGGACCACGACCTCTAGAGTGAATTTTGTCATCCACCATATGCTTAAGTCTCTGGTAGTA
AGTTGGACCTAAGAAAATCATTGCAGTCAATTTTCTCCCAGTATGACCATTGTACATGGTCTCAAATCCACGCATCTGATAGCCACACTTGTGCAGTGCT
TTACTGATATTATCCACAGTAACATCAGTGAAAGGAGTTGCATCTCCTTCCTTTCCCATGTGAGCCGCAACTTTACCCATAATACACTCAATCAGCTGGC
CAATAGTCATACGGGATGGAATAGCATGTGGATTCACAATGATATCCGGTGTGATGCCTTCGATTGTCCATGGCATGTCCTCTTGTGTGTAAGTCATTCC
AACAGTTCCCTTCTGACCATGCCTACTGCTGAACTTATCTCCTATTTGTGGTATGCGCACTGATCGCATTCTAACC
page-top