Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15875  (registered. 2007)
Contig Information
Length 1152 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Formin-like protein 7; AltName: Full=OsFH7
Score 1123
Evalue 1.07914e-120
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15875
AAATTTGTTTGTCGCCAGGGGGGGAAAAACCCCAAAATATACAACATATGTATGTACGAACTTCTTTCCCTATGGACAGTGAGCAGCGGTACAAAACTTT
ATCTATGGACAGTGAGCAGCAGTGCGCTATACGTCTATGTGCTAAATGCGTCGCTATATCAAGTCTACCTATCAATCACATTTGCCACATTGGTATGCAC
TACTGCCTGTGACTTTTCTTTTTACACGGAGCTTTGTCTTCCTGGCCTCCACTTTCACACGGTAAGAAATTAGTGGAAATATGTCGTGTCTAGCTTCGAC
GACGGGTCAGTCATCGGTCGGAAACTCCTGGCTCCGGCGACCCCGCCTTCTTGTGAGCGGCGGCTGCCTTCGCCTTCTCTCGTTCAGCTTCCATCTGGGC
TTTCTTCTTCTCCGCCTCCGCCTGCCTGAGGTTCTCGGCATGGGCCCGCTCGAAGGTTTTCACGAAGCTTAGCAGAGTAGAGACAACTTGCTCAAACGGG
CACCGCACAGGATCTTCACCAAAATAATGTGCTAGAGAGTCCGCGCTTTTCCCCGCTGTACTGTAAAGCGAAGCTAATGACCTCCCTTCAGCTTGGGCAT
CAGCCAGAAATTCCTTCAGTTTCTTGTAAAACGTCTCAGACACTGGACCATCTTTTTCAGATGTTGCCAGTTCCTGCTCGACCTTTTCCAGTCCCTTAGT
TATCGCTTGCATTTCCTCCGCCAAGTCTTTCAATTGGATCTTTGTGGCGGGTTCTAAATGCGCAAGATCCTTAACAAAATCAAGAACTTCAGGAAGCTTG
CCTGCAAGAACCTTGCACAAATAATGCATGAGAGTCATCTTATTGTTTCGTGCCCGTATATCAATGAGCTTAAGAAGACTATCTAATCTAAATCCAACGG
CTGAACCCCTTGCAGTTCCTTGGTTTAATGCATTCCCCAAGGAAAGAATTGTTTGCATCACTCGCTTAAGCTTGTCAGAGTTCCTAACCTCTTCAGCAAC
ATCATTAATGGTATTCAGGTTATTTTTCACGTCTGCAACCTGTGTAAGAAACTTTATCTTAAAGGATAAGATTCTCAGTTTTGACTCCACCCTTGGCACT
TTCATCATTTCCAAGAAGAACTGCTCACATTTTCCTAGATTCTCTTTGCTGC
page-top