Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15792  (registered. 2007)
Contig Information
Length 776 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0816300 [Oryza sativa (japonica cultivar-group)] >gi|113550162|dbj|BAF13605.1| Os03g0816300 [Oryza sativa (japonica cultivar-group)]
Score 707
Evalue 9.79094e-73
Total Hit Count 29
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15792
AAGACAGAGTTGTCCACTGGTATAGAAAATGATGAAGCGTCTGAACAAGAGCAGACCTACCCAGAGAGTGCTTCAATTGCTCCTTCAGGTATGGATCACC
AGGGTGAGAATAATAACAAAGGGGCTGAAGAATCGATAAAAAACTATGGGAAGCATGTTTCTGATCCAGTAAACACAGGTTGCCAAACCAGTAAATTTGG
CCGACCAAGTATTGAAGAGGGCAGGAGAATACATAGTAGCAGTATATCTGTCTATCTGAAAGACATCACAGTATATCAGGAAAGAATTCGTTCTGATCCA
TCAAAGAGTACACATATAAACAATGCTGGGTATTATTCTCGACATGGAGCTCTGGAACCAGTTTCAGTCAGCAAGGATATCAAAGTTCCATTGCATGATA
CTGGGAGGGTTTGTGGAAGAGATCGTGCACTGGAGTTGGTGACAGGTCCACCAGAAGAGACGCCTCGATGGAGACAAGAGCAATATGCACTTAATATTTT
AGAAGATGTGCAAAATGCTCGCAGTGCTGAGAAAACTAGGATGGAGATGGAGATCAGAATACTGAAGGCACAGATTGCTAGCATGCAGAGACAAGTGATG
AACATGGATCATGTTGGTGAGGTTATTTCCAGATCAAAAAGGCATTGACCTTTTAATTAGCTCCATGATAAATGATAGGTTAGCATAAAATTTCATGTAG
AACTGTACTTCCTTTGTGAGATCAAAGACCAATGCACGCTAGTTTGTTTCGTTTGTGTTGACTCTCCATGAAGGTC
page-top