Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15782  (registered. 2007)
Contig Information
Length 528 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit annexin-like protein rj4 [Oryza sativa (indica cultivar-group)]
Score 552
Evalue 3.68158e-55
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15782
CCACAAGGAGCAAGGCTCAGCTACTTGCAACATTCAACAGCTACAATGATCAGTTCAGTCACCCCATCACCAAGGACCTCAAGGAAGACCCAAAGAACGA
GTTCCTGTCAACCCTCAGGGCGATCATAAGGTGTTTCACCTGTCCTGACAGATACTTTGAGAAGGTCGTCCGGTTGGCCCTTGGAGGCGTCGGCACAGAC
GAGGACACCCTTACGAGGGTCATAACCACTCGCGCTGAGGTGGACCTGAAGGTGATAAAGGAGGCGTACCAGAAGAGGAACAGCGTCCCGCTGGAGAAGG
CTGTTTCCAAGGAAACAAGCAGAGACTATGAAGATATGATGCTTGCACTTCTGGGGGCAGAGTACTGAGGCATGTGCCTGATCTACCATATGCTTGATGA
TGGGGGAATAAGAGTGCATAAAACTGTCGAGTGTGTTGTTTTTCATGGATGATTATAAGTTAGCCTGCATGGCAGTACTCGTCCGATGAATTATATCATT
TCGTCATTTGAGCTGCAGAAAAAAAAAA
page-top