Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11085  (registered. 2012)
Contig Information
Length 1570 bp
Clones alternative view 37 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 3
Wh_h Spike at heading date 2
Wh_CSEC Callus 2
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|11993907|gb|AAG42150.1|| 26S proteasome RPT6a subunit [Dactylis glomerata]
Score 813
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11085
TTTTTTTTTTGCGTAGCTAATTCAACGAGTTCGAGTATCAAACATTACACGTAGTTAATTATGCTACCACATGCGTATCTTAAAAACTTTGTTAACCATG
GAACGACATAAGTTCAGAATACAAGTCCAGCAACGTGCAGTTACACGCTTCCACAGACTCAAGCGGAGAAAGCTCGGGTCCTCACTTCCACAGCTTCCGC
AAGGACATGTTCTTCTCATTGTCCTTCTTCATCACCTTGGCCACCGCCATCTCGAAGTCCTCCTGTGTTACGTGCACCCTTCTCTCGCGGAGAGCAAACA
TTCCGGCTTCGGTGCAGACCGCCTTTAGCTCAGCTCCTGAAGCGCCATTCATCTTTCCCGCAATCTTTTTCAGATCAATACCACGCATCAAGTTCATCCT
TCTTGAATGAATCTTCAAGATATCACCTCGTGAATCCTCATTAGGATTTGGAAATTCAATCTTCCTGTCTATGCGGCCAGGCCTCAAAAGGGCTTGATCC
AAGATGTCTATCCGGTTTGTTGCCATCAGAACCTTAATTTTGTTTGATGCTTCAAAACCATCAAGTTGGTTTAGAAGCTCAAGCATGGTCCGTTGCACTT
CACTATCACCATTGCCAGTTCCAGACTCCATTCTAGCAGATCCAATGGAGTCTATTTCATCCATGAATATAATAGACGGTGCATGCTCCCTAGCCATAAC
AAAGAGTTCACGAACCATCCGGGAGCCCTCACCAATATACTTCTGAACCAACTCAGAACCAGATACCCTGATGAAGGTACAGTCGGTGTGATGAGCAACT
GCACGTGCCAGTAATGTTTTGCCTGTCCCTGGTGGTCCATAAAGGAGAACACCCTTTGGCTGGGCAATTCCAAGGCTCTCAAATAACTCAGGATGTTTGA
TAGGAAGCTCGATGACCTCTTTGATCTCCTTGATTTGCTGATCAAGACCTCCAATCATATCATATGTAGAATCTGGGACCTTCTCAACTTTCATAAGATT
GACCAGTGGATCAACTTTGCTTGGAAGGACCAAATGAAGCATATAGCTATCATTCCGAAGAGCAACTCTTGTTGAAGGTGTGATTTTTGTGATATCGATG
CTCTTATCAATATCTACTACATATTTGCCTTCTGGATGCACCTTAACAAGAACCTTTGATTTTCCCATGACCTTCACCACCTCACCAACATAAGAGCCAG
GCTCCTGGAGTAACTGTAGCTCTTCCCTAAGCATTCTAACTCGGGAGTTGAGGTCGTTGCGCTGGGCCTCGAGGCGATTGAGGTTGTGCGTCTTCTGGCG
GATCTGGAGCTGCAGGTCGTGGATGTGCTGCAGGTAGTACTGGCGCAGCCCCTCGCCTCCGCCACGCGCGCCCTTGGCCGACTCGTCGCCGGACGCGGCC
GGCGGGGGCTTCGAGATGTCCATCGCCACCGTCGCCATGGAGCTGGGCTGGGGTTTGGTTTGGTTTCTTCTGCTTGCGGTCGACGAAAGCTTTATTCCTC
GGCCTCTTTCTTCTTGCGGCGGAAGAAGAAAGCTTTTTTTTTCTCGGCCCGGAAGCGGAGTGGGTTGTTT
page-top