Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11082  (registered. 2012)
Contig Information
Length 831 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|46358940|gb|AAS88729.1|| vacuolar invertase1 [Triticum monococcum]
Score 279
Evalue 2.00E-73
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11082
TTTTTTTTTTCATTTCGAAAAATTGGTGGCAGCGCACACGCGCGCCTCTTTCTTTCCCCAATAATTTCATTTACAATTGATTGATCAATACGATCACCAT
CATCATAGTCCTGCTGCAGGATACATATCCATCCTGCCAATAGTTACACTTGGAAGGCAGTAATCATCCTGCCAACAAATCATCTAACTAATTCATCTCA
CCAAAAACCCAAAATCCAAAAGAAAGAAAAAACAACAGACAAACGAACAGAAAGATGACTAGAGTAGCTAGTACTCCATCTCCATCCATCCATGAGGGAG
GAAGCCGCCGACCGATCAATGTGACCGCCGATCGAATCATAATATGTAGTATAGGTGAATATGCATTACCGGGCCAAGAGCTTGATTAGATTCAGCTACA
AGGCGGCCGAGGCGTCGTCGGCCGTGAAGATCTGGTTGTAGGAGTCGTCCATCTCGTGCACCACGAGCTTCTCGACGGTGACGGCGGCACCGGTGGCGTT
GTTGAAAAGGTAAACGCCAGCGGCGGCGTAGATGGCCTCTGTCGGGTACACCCTCGACGTCGCGGTGGACCTTCCACCCATGGCGAAGGTCTCCACGATC
GAGTGGTCCACCAGCACCCTGAGGGATAGATCCTCACCGTCGAGCACTGGCACAGTGAAGCCGACCACCCGCTTCACGACGTCCTGGGCCAGCGACGACC
GTGACTCGTCCTGGCAGAAATGGGTCTGGAGGCCGCCATCGAGGCCCCTCGACACGTAGAAGTACACCGCCGTCTGCTCCTTGAGGGCGCCGTCAGCGAG
GACGAGGAGTCCGAAGGGGCCGAGAGCGCCA
page-top