Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15664  (registered. 2007)
Contig Information
Length 1414 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_V483 Shoot grown under cold condition for 3days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38981 [Oryza sativa Indica Group]
Score 1036
Evalue 1.76192e-110
Total Hit Count 97
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15664
GTACTACCACTACCAGAACGGGTGTGGCTTCCACCCCAACTGTTCAGCTAGTTCCAAATAAAGGACCTCCGTCTGTTCCTCCAACTCATAATGAGAGGTC
AGTTCCAGTTGCAAGTCGACCTCTGCAGATACCTGTGCCCACCAAATCTGAAACTCAGAAGCCAACTTCTCTAGTAAATAGCTCTAGTGCAACCAAGGTC
ATTACAGCTTCAAGGCCCTTGAGTGCCCCGCAAGTCCCTGCAGCAAAACAAGTGGCACCTGCTGTTTCAACAGTTCAGACTGCACCAGTTCTTTCTCGTT
CGAGGAGTGCAGTTGGACGGTTGGGCAATGAGCCCTCTGCCAGTGCTCCTAGCTACATTCCCCGGTCATACCGTAATGCCATGATGGAGAAAACTTCTGT
TGGAGCAAGCAGTCTCACTCATCAGACTAGTTCCTCAGCGCAAGGAGTTTCACACTCACAATCAATGTTTGCATCATCGGCTTCCATTCTGTCACCAGAT
AACTCTGCTAGGACAGAAAAGTCATCATTGGAACCTGGATTTACGTTTGGAACGGTGAAGCCTGAGTCACTCAATCAGTACCAGTGGAGAGAAGATAGCT
TACAGCAGGCAAGCTGCAGTAGCAGCAGCAGTAATGATCATGGTCTACTGAATTCAAGTGTGGGCAATGAGTCTGATAAGCTCAATTTGAATGGAAGACC
AAGAAGCAAGCAGCTGTTGTCTGAAATTTCGACCAGATTCACTCCATACCAACCGCAAGGCCTGGTCGGCGACGAGTTTCCGCACCTAGACATCATCAAC
GACTTGCTGGACGAGGAGCTCGGTGACAGAAGAAAGGTTCTACAGCCGGGGTTTGTTCGGCAGTTCTCTATGCCGAATAACGTTCCCAATAACGCCAGCA
CACCTGATTATGGCATGTTTAATGATCAGTACCTGTTTGATCAGTCGGAGCAATACTATGATGAGGAGCTTGCACCGTACTACAGTGATCTGAACGGTGG
CCCTCAAGGGCTTAGGGACAGGAGTTATTCACAGTTTGATCTCCCCTCATATTCAAACAGCCAATTTGATGATATGGTGATGGGCCAGTGGCCATACAGC
CGCGCCGACAACTCCATGCCGAACTTCGGGGCAGACATCAATGCCTACCCCTATCAGTCGAGGGATTACCAGACGACCTCAGCGAATGCAGCAAGCCGCT
ACCCATCCTATCACCCTGGGAATGGGCATTGAGCCCTTTCAGAGATGAATAATGATTGCAACCGTAATAATGCGTTGTTGTAGTCCATGCTGTTTGCTTC
TGAGCCGAGTGTAATTGTAATCCTTCCATAGAGCTAGTGGTCTTTTAAAGAAATGCTTCTCAGTTCCTTAATAGCTATGTTTCTTTGCTTGATATATTTC
AGTCAGTTTTGCCC
page-top