Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15656  (registered. 2007)
Contig Information
Length 1087 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit shikimate kinase family protein [Zea mays]
Score 1017
Evalue 1.9487e-108
Total Hit Count 250
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15656
GAGGTCGGTCGAAGCGGCAATGGCGATGGCGATGCGGGCGGCAGCGGCCTTCTTCTCGCCCTCCGTCTCCCCGAGCCCGAAGCAGCAGCACACGCACTCC
GTCTTCTCCCCCCGGCGCGGCTCCACCCGCCGTATCGATCCCCGTCGCCTCCGCGCCTTCCCAGCCACCGAGCTCACCCTCGAGGAGCTCAACCCCTCCG
TCGCACTGCTCAGGAAGACCGCGGAGGCCGTCGGCGATTTCAGGAAGACGCCCATCTACATCGTCGGGACGGACTGCAATGCCAAGCGCAACATCGCCAA
GCTGCTCGCCAACTCCATCATTTACCGCTACCTCTGCAGCGAGGACCTGCTCGAGGACGTCCTCGGCGGCAAGGACGCCCTCGCCGCCTTCCGGGAGTCC
GACGAGAAAGGCTACCTCGAAGTCGAGACCGAGGGGCTGAAGCAGCTCACGTCCATGGGCAGCCTCGTGCTTTGCTGTGGCGATGGCGCCGTCATGAACT
CCACCAACTTAGGGCTACTGAGGCATGGAGTCTCCATCTGGATCGATGTCCCTCTCGAATTAGCCGTGAACGATATGTTGAAGAGCAAGGGAGCACAAGC
TATTTCAGACCCTGATTCCTTTTCTCAGGCAATGGCAAAGCTCCGTCAGCGTTATGATGATCTGAAAGAGCGGTATGCAGTTTCTGATGTTACTGTTTCA
GTACAGAACGTGGCTTCTCAGCTAGGCTACAGCAGCATCGACTCTTTGAGCCTGGAGGACATGGTCATTGAGATTGTGAGTCGGATTGAGAAGCTGATCC
AAGCGAAGGCGATGATGGAAGCTGCTGGGAAGCCTGAATGATTCGAGCATCGACTGATGTCCGAGGAATCAAGTTCCGCCGCTTGGTTTCAATATTTTTG
CGACATTTCGTATACATAGTTCGAGCCGATGAAGGCTTTGGGGGCATGCGCCACGAGTCTTTCACGACATCATAGTAACATGGTACTCCTCGCTGCAAGT
TATTCATGTGGCCAGTTGTAAAATGTATATGGCTCAACGGCCGAACATTAAACCAGGAGATTTTTTTTCTTCCAATGAGTAAGGAAG
page-top