Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15608  (registered. 2007)
Contig Information
Length 1440 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit SOX transcription factor, putative [Ixodes scapularis]
Score 95
Evalue 0.236646
Total Hit Count 1
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15608
TCTTGGCAACCATCCAGAAAACACAAATCACATAAAAGGACCCCTATTCGCTGCTCTAAAATAGTTCAAACACTAAATGGTCCAAACAATTGAGTAATAT
CCATGACCACAAGATTTCTACTCCAGAACACTCGAGCACCAGTCCAGAACACACATAAGATTCATGATTACAATTAAGTTGGCTGGTCCTGAGCCTGCAC
GCCCTCTCTTTTACTATCTTGCATCTTGCATCTTCCTTTTTTCCTTTCTCCAGAGAAAACATCATTCTACACACAACTTCCTTCCTGATCTTCTTCTCCC
TAGCATCGGATCGCCAATCAACCAAGCACCTGCAGCTCCGCGGTGCATGCTCATGTCCAAGTCTCCCACTCCATCCGCCACCACGCCCATGCCCAGCTGC
TGATAGGCCCTGTAATCATTTGCTCCACCCCTGCCACTCTAATGTTCGAGCTCCTCCTATACCCACTTCTCATATTCTTCCGAGTGATTTGAACCTTACG
TTTCACGACATTACCTAATATTTACACCGCTCATCAGAACGGATTCTTCTACAAGGAACAAGCAACCCAATAAGTTCACGGCTAGCACACATCACTTTCT
CCTGCTTCCACCATGTGACATTGTAGTCTCGATCCTACTATCTACATCCCATTGGAACAATTCTGAACTTAGAGAAAATGGTCGAGTATCTTAAGTCCTA
AATAGAAGAAAGCTTCCCGGCATGCAATCTTCGTATCTGTATATTTTTGCCTCCTGATGGAGGCGTTTCATGAGTAGTCTCGTGTTGACCTTACTGCCGA
AGTGCACTCTACACTATCAGGCGTTTTCTTTTCTTTCCTCTGCTCCCTTAGAGGGCCTTTATAGATTCTTGTTCAAATCTAATATCATTGCCTCTATGAT
GTTCCTGTAGTCGAGATCCACCAACTCGCCACGGACCCAGGTCATCTGACCAGACGCCTTGACATTCCGTCACCCACCGCTTCCTATTGGAAAAGACGAG
TCTGTGCGGAGATCTGCAGCAACAGACGGCTGGCTTCAGGAGGGGCGCAGCGGTATGGAGAGCTCGTGGATGGATCTCTATCGGCGGCAGCAGGAACGGG
GAGCACGGGTGGAGAGCTCGTGGCAGGGCTGGGGCCCGGGGCGGGGTCGACAGGGGAGAAGCGCGAGGAAGATGGCGGACGAAGTTGGGGGCGGGAGGAT
GGGGATCAAGGGAGGGGGTTGATCCCTGAGCATGAGGACGGCGGCTGGATCTCAGGCAGAGCGCGAGGACGGCGGCTAGATCTCCGGCGGAGCGCGAGGA
CGGCGGCTGGATCTCGGGCGGAGCGCGATAACGGCTGCTGGATCTCGGGCGGAGCGCGAGGACGGCGGCTGGATCTCGGACAGAGCGCGAGGACGGCGGC
GACAACAGCAGTACCGTGGGTGGAGAGCGAATACGGCGGC
page-top