Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15603  (registered. 2007)
Contig Information
Length 761 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 2
Wh_RDr Root of dessiccated seed 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit MAP kinase [Triticum aestivum]
Score 951
Evalue 4.78434e-101
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15603
TAGAGAATGATTTGCCCTCAAATCATGCTCCAAACTTTTTATTCGCACAGCTGAGGGACAAAGGTTTGAAGAAGCAGCAACAACTTACACAGAATAAACA
AACAAATGCAGTGCGCAATCTACCATGTTCTTTGATCTTACTCCTATTTACAGACAGTTTTATACCGAAATCATACTGTTGGGGGTTGGGTAACTAGGAA
TGAATCATCTAGTATCGGAAGTTGGGGTTCAACTCCAGGGCTTCGTTGAATATGAGTTGCTTCATCTGGTCTTCCGTCAGAGGGTGCTGCTCGAAGTCAA
AGGAGAAGGGGTCCGTGCAGATGGGCTCGTCGGCGACGTCGTGAAGCCGCTCTAGGTACGGGTGCTCCAGCGCCTCTTCAACTGTGATCCTCTGCAGCGG
GTTAAAGGTGAGCATCCTCTCGATGAGGTCCAGCGCGGCGGGCTGCACCTTGGGGAACTGGCCCGGGAAGGACCGGCGAGGGAACTGCGGCAGGTGCCTC
ATGTACCTCCTGGCGTCCTCGTTCCGGATGAATCCCAGGTCGTCGTCGGTGGGGGTGCCGATCACCTCCGTGATGAGCCGCATCTGGTGCATGTGGTCCC
TCCCCGGGAAGAGCGGCGCGCGGTTGATGAGCTCCATGAAGATGCAGCCGACGGACCANACGTCGATGGCCGCGGAGTANTCGGTGGAGTTGAGCANCAN
CTCCGGGGCCCGGTACCACCGCGTGACCACGTACTCCGTCATCATGTCNCTCTCCNATGAC
page-top