Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15585  (registered. 2007)
Contig Information
Length 1437 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMI Dormant seed with water absorption after breaking 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Excinuclease ABC, C subunit, N-terminal, putative [Medicago truncatula]
Score 97
Evalue 0.138328
Total Hit Count 3
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15585
AGTGGTTGTGGAAGCAATGGTTTGTTTGGGGAGGTGGAGAACGTTTTTATGTTATTTTTGGTAGGCATGAAGACACCCATTTTCTATTTGTTCATAGTAA
TTCACTCCCAGGCTTCTGATTGGATCATTACATTGATGTTCCAGCTGCTGGGCTACATGGAGTTGTTTTTGTTTAAAACATATGATCTTGACGCTACCCA
TTTTTCCCTGTCAACATTAGCTTTCTCTCTGCCATTCAGAATTGTTCAGGACAAAACCATGCAGATATAGACCTTTAGTATCCTTCTCATTGATGAAATT
TATTTCCATCTATCCAGTAGGTTCACTGAAGGGGAGCCTTGGCGCAGTGGTAAAGCTGCTGCCTTGTGACCATGAGGTCACGGGTTCAAGTCCTGGAAAC
AGCCTCTTGCAGAAATGTAGGGAAAGACTGCGTACAATAGACCCAAAGTGGTCGGACCCTTCCCCAGACCCTGCGCAAGCGGGAGCTACATGCACTGGGG
CTGCCCCTTTTTTTTATCCAGTAGGTTCACTATAACAGCTAGATTACTTTTAATGTAATTATGATTATTCCACTTTTAATGTAATTTATAGAGCTGACGG
GCAAAAGTTGTGCATGTTTTAATTAGTTACAAAAGATATAGTTGGAACTAATAAAATCATGTTCATTATTTGGTAGCTAAGTCAGAACTCGGAGTCGGGA
CAACTCAACAAGGGAACGAGGAGCCTCAAGGGAGATACCTGCATAACACTGGATGCAGTGAAGAAGGAATCAGAAATGTTCTTATGTTTTAGTGGCGGAA
TGGCAAGGCGTCCGGTTAGATGACCTGGGTCCGTGGCGAGTTGGTGGCTCTCGACTACAAGAAGATCATTGAGGCAATCGATAGTAGATTTCAACAAGAA
TCTATAAAGGGCTCTAAGGGAGTAGAGGAATCAAAAGAAAACACCTGACAGTGCAAAGTGCACTTAGGCAGTAAGGTCAACACAAGACTACTCATGAAAC
GCCTCCATCAGGAGGCCAAAATATACACATACGAACTCCCGGACATTGCATACCGGGGAGCTTTCTTCTATTTAGGATTTAAGGCTGATAATATGCTCAC
GAAAAGACAGGAATGCAGCACCACTCCAATCTTTAGAAGGTCCCCACCCTGTTCTGTGATGAATGTGGATAAAGACGAAGCAGAGAACATAATATCTTGG
TGAAGGCATCTCAACCGAGATGAGACATTGTTTATTTATTTATGTCATATCCTACTCATAGTCTGTTGTTCTGTGAGCAATTGTTTGTTTTTTAACAGCT
TACCATTGATAATGAATCGTGTATGGTGGCTTTGTTAATATTCAAGTAGTATTACATATTAGTAATATTGAATGCATGTTTTTTTGTGGTTTACTTATGA
CTAGGTGCTGTCAAAAAATAAAATTGATGTCCCATCA
page-top