Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15509  (registered. 2007)
Contig Information
Length 1217 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit P450 monooxygenase [Hordeum vulgare subsp. vulgare]
Score 1806
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15509
TTTTTTTTTATGTGCAACATGGTTGGACTTTATTTCAAACATTTGTAGGTATGAAAGCTTATTACATGGCCAACCACTAAACACTATGTAATAAAATGAC
ATCATGCACACTGCTATAATACTGACCGTCATATTGCCCTGAGCTTAATTTGTGCACCATGCATGGGGCGCAACATTTTCTGGTTATGCAGCATATGAGA
ATACGTCGGGCCAAGGTCGAATTCGAAATGTTGAAGGATCATGCACAAAGCCATCTTGGCCTCAAGCAGAGCAAAATTCTGACCGATGCAGATCCGTGGA
CCCCAACCAAATGGGAGGAAGGCACCAGGATCCTTGGATGCCTTGGCGATCCCATCAGCAAACCTTTCTGGCTTGAACTCATGCACATCGCTTCCCCATA
TGTCTGGGTCATGGTGGATAAGCAGCACAGGAAGCTCGATGATCACACCGGCAGGGTAGGTGATGCTTTCAATCTCTATCTCCTTGTATGTTTTTCGCAT
GAATGCAACAGCCGGCGGGTAAAGACGGAGAACCTCGTAAAGAATCATGGTCACGGTTTTGAGTTTGCTAAAGCCGTCATACTCGGGCTTATTCTTCGCA
AATAGGCCAAGGACCTCCTCCCTTGCACGGCCCTGCCACTCAGGGTGCATGGCCAGTACGATCATTGTCCAAGTGAGAAGTACCGATGTCGTCTCTGACC
CTGCAAAATAGAACAATTTGCATTCCTCTATCACTTCTTCAATTGTCATTCCTAGGATGGGCTGACCCTTGTCGTCTGTTTCCCTCATGTTTGACTCAAG
CATTAAGCCGAGTAAATCATCTTTGGTGCTTTCTCCTTGTTGCATCGCTTGCATTCTTTTTTCAATCAGGCCTCGTAGAATGGATTCAATCTCGTTATTA
GTTTGATGCATCAGTCTGTTCTTGGTAGGCAAGGACATGTAACCAGGAATGAAGATCTTCTTAACTTCTGCCACAATGCGGTCGGCTTGCTCAGACTGCA
GCTCGAAAATCCTTCTTCCTTCGAGGTAGCTGCTGCCGAACGCGGTGCGTGAGATGACATCTCCAGTGAGGGTCTGAAACTCCGGGCAAACATCCACCTC
GCACCAACCGTCAGAACCAAGAGCCTGAGTCCATCTGCTCACAAGCTCTTCACAACACGCAGAGAACGCCGGCATCATGAGCTTGAGCTTCTCGATATGG
AAAGCGGGGTTGAGAAT
page-top