Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15489  (registered. 2007)
Contig Information
Length 1598 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 78
Evalue 0.559124
Total Hit Count 4
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15489
GTAGCCACGGCTGACCAAGAGGAAGGTGTCTCTTGGCAAAGCTATTGCCTCCTTCTTCCTTGGTCCATGCGTGGGTGTGTGTGTTTTCTGAGAATTTCTT
CCATGGTGTGTGCTTGAGAGAAACCACAAGAGAGAAGGTTGAGCTGTGAGAGACAGCCAAGAAGAAGAAGAAGGCGCTGCGAGGAGGCGGCGCCATCGAT
TAGGAGCAGTTTATCACGCAGCTTGTACGCATGCCGCCGCCGCCTTTTCGCCTCGTACCTATATTGTGGCGGGTGAACAAGGGAATCTCGCTGGAGGCCC
TTTTGGAAGGGATCTCGGTGGCGCACCGCCGTTGCGTGTCGTTCGTCGATCTACAAGAGATCAAGAAGGGTGATGTTCTGGATGCTGATCTCAACTAATA
GTTGCCAGATGAACTATGCAATGACAGCATGGATGAGCTTTGTGTGCAGTTCACATTTACCTGGTGGACCATCACCAACCGGATGGAGGTGAAGCAAGTG
GGCAAGTCAGGGAAATGCTCGGAAGGCTATCGAGAAGATCAACGATCTTAACCCCACGATCCTAATTTCAGTTTGTACCTCGTTGTTGGGCTGTCAGAAA
AGTTTGGAGCAGGAGCAATGATATGACAATTGTGGCTAACTTTCTTGTCATTAGTCATATATGTGCTAATGGACCTTCCGGGTTCTCCATTATGTTTACC
GGCCGGTTTCTCATCTGAAAAATACCCCATAGCATAGTGGACAATGCTTTTTTTGGTCAGAAGTAGTATTTCTACATGAAACTAAGTTATATATGCGTAT
GAGAAATGTGGCTTATCTTTTGATAATGCTTTTTTTGTTAGAAGTTGTTTTTCTACATGAAATTAAGGTATATATGCGTATGAGAAATTATATCTTTGCT
TAACTCAAAAAATTGTATTTGCTCCTTTTAGCGGGAGCCTGGAGGTGATACGGTTTGTACATCATGGTTTGAATAAGATATTGTTTGTATACTGTTGAGT
GAAGTATTGTATAACTACTGTAAAGTGGGTGTAGGTTTTTATTGTGCATTTTTCACAGAGGTTTGGGCGTTTGGACACAACCATATGTACAAGTTGAAGC
CTTCATTTGCAAGCATTTCTTTAGGAAACAGAGAAAATCACAGCAACTATTTGATGTTTCTCGACGCTTGAAGACAACAAGTGAAGTTGTTGCTACCATC
TTACAAGCCAAAGTCATGAGAAAGCCGGGTGTTAAAATGTTGGGAGATTACAAAGTTCATGCTCTATTCACACATGGTGGAGGCAACCCAACAAGTTGTT
GTGGGAGCCAGCAGAGAAAGGAGTCGAGGAACCCGCATCATGGGAGAGTCATCGAGGGGCATCCGGATAAAGCCTATATACTGGATGAGATTCTCATTGC
CGGCATTTTTCATGAACCTATCAAGGAGAACATTTCAATACTAATTGCAGCACATGTTTTCTCACCACCGGCTAGCAAGAAGAGAGTATGATTTTCTAAT
GCTCAGTGTTGTAAGCTTGATTCACGAGGAGCTTCTCAATGTTGTACATGTTGTTTGTGAGTAACAGAAATAAATCATTTCCTGGAATCAGACGCTAT
page-top