Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15450  (registered. 2007)
Contig Information
Length 178 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_000669 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 1245
Evalue 0
Total Hit Count 0
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15450
CTAGATCGGTGGTGGTTCGATGAGTCTCTGTCACAGCGTTTGGTCGATCGGTTGATCTTGTTAGGCATTCTTTCTTTTTGTCATATATATATCCGCTACA
TTATACTGCTGTGTGCTGTTTTATATGAGATTGGGTTGCTATGAATAAAGCATGATGATCCCGTGATCAAAAAAAAAA
page-top