Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15340  (registered. 2007)
Contig Information
Length 1117 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_21033 [Oryza sativa Indica Group]
Score 1490
Evalue 2.89111e-163
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15340
CCCCTCCGTCGTCTACATCACCAACCTCGCCGTCAGGCAGGACGCCTTCACGCTGGACGTGCTCGAGGTGCCGCAGGGCTCCGGCTCCGGCTTCGTCTGG
GACAAGCTCGGCCACATTGTCACCAACTTCCATGTCATCCGTGGCGCCTCGGACCTCAGGGTCACGCTTGCTGATCAGTCGGTGTATGAAGCGCAAGTTG
TCGGATTTGACCAGGACAAGGATGTTGCGGTTTTGAGTATCGAAGCACCAAAGGATAAACTAAGACCTTTACCAGTTGGTGTGTCAGCGGACTTACTGGT
TGGTCAGAAAGTGTATGCCATTGGGAACCCATTTGGCCTTGACCACACTCTTACAACAGGTGTTATCAGTGGACTGCGACGAGAAATTAGTTCAGCTGCA
ACTGGACGTCCTATACAGGATGTAATACAGACTGATGCTGCTATCAACCCTGGTAACAGCGGAGGCCCACTTCTTGATAGTTCTGGAAACCTGATAGGTG
TAAATACTGCTATATACTCACCTTCAGGAGCATCATCCGGGGTTGGCTTCTCCATTCCAGTTGATACAGTTGGTGGTATTGTGGATCAGCTTATACAATT
TGGGAAAGTGACGAGACCTATTTTGGGGATAAAATTTGCCCCTGACCAATCTGTGGAGCAGCTTGGATTGAGTGGAGTGCTTGTCTTGGATGCCCCCCCG
AACGGGCCAGCTGGCAAAGCGGGTCTGCAATCAACGAAACGGGATGCCTACGGACGACTTATCCTCGGGGACATAATTACTTCTGTTAATGGTACTAAGG
TTGCGAATGGAAGCGACCTGTACCGTATCTTGGATCAGTGCAAAGTCGGAGAGACGGTGACCGTGGAAGTATTGCGCGGAGATAAGAAGGAGAAGATCGC
TGTGGTCCTTGAACCAAAGCTCGACGAAACATAGTGAGTGGTGTCCTTCTCGGGTGTATTCTCACGTAGGTACAAGGTATTAGCATGTTGGCCTACCACG
GAGCTCCTTGTACATAATTGATGTTTGTAAATTTTCTGGTGTAAAAAGAAAGGAAAGAAAAATATCATTTTGGTTCATGCCTTATGTGTGCTGTTCCAGT
ACCATGATGTATCTGCT
page-top