Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11038  (registered. 2012)
Contig Information
Length 2327 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_EM Dormant seed with water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_SHC Shoot grown with cold treatment 3
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 5
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125534240|gb|EAY80788.1|| hypothetical protein OsI_35968 [Oryza sativa Indica Group]
Score 1357
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11038
CCGCCTTGCTCTGCGCTCCTCAACCCCTTCGCCCGTGTCGACTTCACCGCCAAGATCTGGATCTGCCCGCTCTGCTTCTCGCGCAACCACTTCCCCCCGC
ACTACGCCGGCATCTCCGAGAACAACGTGCCCGCCGAGCTCTTCACACAATGCTCCACCGTCGAGTACCTCGTCGCCGGACCCCCGGGATCTCCTGCACC
GCTGCCGCCAGTGTTCCTGTTCGTCATCGACACCTGCGTCATCGAGGAAGAACTGGAGTACGTCAAGCTGTCCATGCGGAAGGCGGTCGCGCTTCTGCCG
GAGCACGCACTTGTTGGCCTGGTGACCTTCGGGACGCAGGTGCATCTGCACGAGCTTGGGTTCTCCGAGCTCAGCAAGATCTACGTGTTCCGGGGGAGCA
AGGAGATCTCCAAAGAGCAGATTTTGGATCAGCTTGGGTTATCAGGCGGGGGGCGGCCAGGGTTCCCAAAGATGACACAGCAGCCAGGCGTGCAACAGGT
CAATGGGATGCATCCATTAGTCACGACAGGGGTTAACAGGTTCTTGCTCCCGGTATCAGAGTGCGAGTGCACGCTCAGCACGCTGCTGGACGAGTTGCAG
CCTGACCAGTGGCCGGTTGAGGCTGGCAACCGTGCCATCAGGTGCACGGGTGTTGCGCTAAATGTGGCGGCTGGGTTGCTTGGGGCATGCGTGCCTGGGA
CTGGTGCAAGGATTATTGCGCTACTTGGCGGGCCATGTACCGAAGGTCCTGGAGTGATTGTATCAAAAGATTTGTCTGAGCCAGTTAGATCACACAAGGA
TCTTGATAAGGATGCGGCGCCTCATTTCCAGAAAGCCGTCAAATTTTACGATGGCCTTGCCAAACAATTGGTCAGTCAAGGTCATGTTCTAGATGTGTTT
GCATCTGCTCTTGATCAGGTTGGACTAGCTGAGATGAAGCTTGCTATTGAGAGAACAGGCGGCCTTGTTGTCTTATCTGAGAGTTTTGGGCATTCTGTGT
TTAAGGATTCTTTTAAACGTATTTTTGAGGGAGGTGAACATTCATTGGGCCTGTCATTCAATGGCACATTTGAAATAAACTGTTCAAAGGACATTAAAGT
TCAGGGTGTTATTGGACCGTGTACATCTTTGGAGAAGAAAGGAGCTTTATGTGCAGACACAATTGTCGGTCAGGGAAACACAACAGCATGGAAAATGTGT
GGGCTTGATAGGAATACTTCACTTACAGTTTTTTTTGATGTCTCACCGAGTGAACGCTCTGGCCAACCAGGTCATCAAAATCCCGATTTGTACATACAGT
TTGTAACCAGTTACCAACACCCGGAAGGTCAAATGAGAATAAGAGCTACTACTGTATCCAGAAAATGGGTGGATGGTTCTACCAATACTGAGGAACTAGT
CGAAGGATTTGACCAGGAAACTGCAGCTGTTGTGTTGGCAAGATACATCTCCTTGAAAATGGAAATAGAGGAAGAGTTTGATGCAACACGGTGGCTCGAT
AGATCTCTCATACGACTATGTTCAAGATTTGGGGATTATCGGAAGGATGACCCCTCTTCATTTAGCCTACATTCTAATTTCTCACTGTTTCCTCAGTTTA
TGTTTAATCTCCGGCGTTCGCAATTTGTTCAGGTTTTCAATAACAGTCCAGATGAAACAGCCTATTTCCGAATGTTACTCAACCGAGAGAGTATCACTAA
TTCAGTTGCAATGATTCAGCCGTCATTAATTTCATTTTCTTTCGATTCACCTCCTTCTCCTGTATTCCTCGATGTGGCATCAATAGCAGTAGATCGTATA
CTGCTGCTTGATGCATACTTCAGTGTTGTCATATTCCATGGAATGACAATCGCTCAGTGGAGAAACATGTGTTATCAGAATCAGCCGGAGCATCAGCAAT
TCGCACAATTATTACAAGCTCCTCAGGAGGAGGCCCAGGTGATAATAAATGGTCGATTTCCAGTTCCTCGACTAGTTGTCTGTGACCAACATGGCTCCCA
GGCAAGGTTCTTGTTAGCAAAACTAAATCCATCGGCCACATATAATTCAGCACATGATGTTCCACCAGGTTCTGACATCATATTCACTGATGATGTCAGC
TTCCAGGTCTTCTGTGAGCATCTACAAAGGCTGGCTGTTCAGTCGTAAGGAAATGCATGCAGAGTTGTACTCCCAAATTGATTGTTACTAGCTATTCGAC
GTTTGTTTACCTACCTGGCTCGCTCATAGTTTTGACTGTTTTTTGGCCATATGTCTTTTCATCATGAATTCAACTTCTGGAAATAAACATAAAAAAAAAG
TCATTTGCAAGGTGTCCAAAAAAAAAA
page-top