Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15219  (registered. 2007)
Contig Information
Length 726 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown protein [Oryza sativa Japonica Group] >gi|215740449|dbj|BAG97105.1| unnamed protein product [Oryza sativa Japonica Group]
Score 198
Evalue 9.11468e-14
Total Hit Count 20
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15219
CACACACCTGCAATACCAGTGCTTGCCAAAAACCGCTCAGCTGCTTGCTGACAAGTGATAAGCTTCTCGGTCCATTAATCGGTCGACCCGCGTCTGGTGA
AGATGGGGAGGGCGAACTGCTCGGTTCCTCTCCTGGTGTTGCTGGCCTTCCTCTCCTGCTTCTTCCTCGCACACGCGGCGGTGGCCGGGGCCGGCGGCAA
CCGCAAGATGTTCCTGCCGAGGGAGGGAGCGGCAGCCGCCGCCGTGTCCGACGATGGTGGGCAGGCGATGCCGACGACGGCGGAGGAGGTGGCGGTCGGA
GGAGAGATGCATCTGCTGCTGAGCGACGACGAGGAGATGTTGGCCAGGAGGGTGGACCTGCAGACAGAGGACTACCCGGGGTCCGGGGCCAACGGCCGCC
ATGATCCACGAAACCCGCATTAAGAGTTATTATGCCGTGCTGCATGTACGATAAGTGCATGTAATTAACCGCATGTTTAGTTACCCCCACAATCATGCAT
AATTAAGCATATATATCATCACCACGTTGCTAAACATCATGATCTTAATTTAATTTGCTAGTGTATGCATCTTTGGTTGATAATAACAAATACTCCCTTC
TTAAACTAATATATAAGATCGTTTAAATAGGGATCTAAACGATCCTATATTAATTTATAGAGGGAGTAGTTGTAGTCCCTATAGCTTGGGATTAAGCATG
TTTCATCTCTGTCATCAAAAAAAAAA
page-top