Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11034  (registered. 2012)
Contig Information
Length 789 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_CA 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242073268|ref|XP_002446570.1|| hypothetical protein SORBIDRAFT_06g018280 [Sorghum bicolor]
Score 374
Evalue 5.00E-102
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11034
CAGGCCGTTCTAGGGGCTATGGATTTGTTAGATTTGGAGATGATACTGACAAAGCTCATGCAATGACTGAAATGAACGGTGTTTATTGCTCTACTAGACC
GATTCGCGTAGGACCTGCAACGCCTAGAAGAACCTCTGGTGATTCTGGTTCCTCAACACCTGGCCATTCAGATGGTGATTCAAATAACAGAACGGTATAT
GTTGGTGGGCTTGACCCAAATGTTAGTGAAGACGAGCTGAGGAAATCATTTGCCAAATATGGTGATGTTGCCTCTGTCAAAATTCCTCTAGGGAAGCAAT
GTGGCTTTGTTCAGTATGTCAACAGAACTGACGCAGAAGAAGCACTGCAAGGATTGAATGGGGCTGTCATTGGAAAGCAGGCAGTTCGCCTTTCGTGGGG
CCGCAGCCCATCACACAAACAGTCTAGGGGCGATTCCGGCAACAGGAGGAACAATAACAACATGTACTATGGTACGCCGTTCTATGGCGGGTACGGCTAC
GCGTCCCCCGTGCCGCACCCCAACATGTACGCCCCTGCGTATGGAGCCTACCCCTTCTACGGTAACCAGCAGCTGGTGAGCTAGAGAGAGAAAGAGCTTC
GTCCCACTCCCTCCGATGGGGAACAAGGTTTTGATCCGATGAGAGCATAGCAGCGTCAGAAGAGAGAGAGTGAGAGAGAGAGAAAGAGAGAGAGAGAGAG
ATTATATAGATCGTCCTAAAGTAAGAGGGTGAGACAGGTTATTAAAGAGTGAAAGAAACGAGTGGTGTCTGTACTCTGTAGCGTCTGTT
page-top