Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15123  (registered. 2007)
Contig Information
Length 1419 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_V483 Shoot grown under cold condition for 3days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 14-3-3 protein homologue [Hordeum vulgare subsp. vulgare]
Score 985
Evalue 1.45778e-104
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15123
GGCACCCGTGAGGAGAATGTGTACATGGCCAAGCTTGCCGAGCAGGCTGAGCGTTACGAAGAAATGGTTGAGTTCATGGAGAAGGTGGCAAAGACCGCTG
ATGTTGGTGAGCTCACTGTTGAGGAGCGCAACCTGCTCTCTGTTGCTTACAAGAATGTGATTGGTGCCCGGAGGGCTTCCTGGAGGATCATCTCCTCCAT
TGAGCAGAAGGAGGAGAGCCGTGGGAACGAGGCCTATGTTGCTTCAATCAAGGAGTACCGTACCAGGATTGAAACTGAGCTCAGCAAGATCTGTGATGGC
ATCCTCAAGCTTCTGGACTCCCACCTTGTCCCCTCTGCCACTGCAGCAGAGTCCAAGGTGTTCTATCTGAAAATGAAGGGTGACTACCACAGGTACCTTG
CGGAGTTCAAGGCAGGCGCTGAGAGGAAAGAAGCAGCTGAGAACACTCTTGTAGCATACAAGTCAGCCCAGGACATCGCGCTTGCTGACTTGCCTACCAC
CCACCCGATAAGGCTTGGACTTGCACTCAACTTCTCAGTGTTCTACTATGAGATCCTGAACTCTCCAGACCGTGCTTGCAACCTTGCCAAGCAGGTTAGT
CTTCTGTTTTATACATCACATCTTTTGTTGAAGAGTTCTTCTGTGTGGAGCCCTGCTTGTTAATTCTTTTATTTGATGGGAGCTACACCTGAGTCCCATT
TGTCATGGAAGCTATATACAGTACAATTCTGATCTCTGGTGAAATTGTTGTTTCAGCATTTCTTATGCTTTACTTTATGGTACTATATCAGTTTAAAGTT
TTTTATGAATGATGAACAACAATCCTTGTTAACTATGCCAACCAGTTGAAACGACTCATGCTATTGAAAGTATAGTTTGAACCATTACTTGACATTGAGG
AAAAAGGGTCTCAGTCTACATCTGTCAATAATGTTTACTTGTTGGTAGGCATTTGATGAAGCTATTGCTGAGCTGGACTCCCTCGGCGAGGAATCCTACA
AGGACAGCACCTTGATCATGCAACTTCTTCGTGACAACTTGACTCTCTGGACCTCCGATAACGCAGAGGAGGGTGGTGATGAGATCAAGGAAGCCGCCTC
AAAGCCTGAGGGAGAGGGGCACTGATTGGCCCTCGAGCGTGCCCAAGTTTATTTCTGAGTCCATTTACGCAGCTACCTGTATCATTCGGATCATAAGATG
TACTAGGGTCGGTTGCACTATGTGAATCATAAGATGTGGTAGGATGGTGCTATGCGAAGCGTGTCGAGCTGAAGTACCTAGTGGACTACAGTCATGAGGA
CGGTCATGTGGACATCGTCGCTTCTTAGTTCATTAGCAGATTTCAAACTATTTCCTGTATTGCAGCACATTATTAGTATTGCTGTATTAGCAATTTTCAT
GGCTTGTTGATGATTGATC
page-top