Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15118  (registered. 2007)
Contig Information
Length 735 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_012848 [Oryza sativa (japonica cultivar-group)]
Score 1058
Evalue 1.39753e-113
Total Hit Count 467
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15118
TTGCCGATGTCTCCAGTTGAAGGTTGCCCGACTGTATTTCAAGCTATCTGCAGCTTACCTCCAGGGATTTATCAGTACAAGTTCAATGTGGACGGGCAGT
GGAGGCATGACGAGGGGCAACCTACTATAACGGGAGAGTATGGGGTGGTAAACACTTTGTACTTGACAAGGGAATTTGACCACATAAATACTGTACTGAG
CCCCACTACACCTGGGAGCAGGATGGATGTGGACAATGATAGTTTTCAACGAATGGGTTCGTTGTCGGATGGTGCCCTTCAGGAAGGTTCTCCAAGAATC
TCAGAGGCTGCTATACAGATCTCTAGGTGTCGTGTTGCTGAGTATCTGAATGCGCATACAGGCTATGACCTACTACCAGATTCTGGAAAGGTCATTGCTC
TGGACATTAATTTACCTGTGAAGCAATCTTTCCATATTCTCCATGAACAGGGGATTCCTGTGGCTCCTCTGTGGGATTCATTCAGGGGTCAGTTTGTTGG
CCTTCTGAGCCCACTGGATTTTATACTTATATTGAGAGAGCTGGAAACTCATGGCTCAAACCTGACAGAGGAACAGCTTGAAACACACACTATATCTGCG
TGGAAAGAGGCTAAGCGGCAAACTTATGGAAGAAATGATGGACAACTTANATCAAATCAGCATCTAGTGCATGCCACCCCTTATGAATCCCTTGAGGGGT
ATTGCCATGAAAATACTCGAAACTGGCATTTCTAC
page-top