Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15097  (registered. 2007)
Contig Information
Length 873 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group]
Score 375
Evalue 3.7763e-34
Total Hit Count 43
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15097
GGCTCCGCGATGCGCTCATGCGGCTCGAGGAGGCGGAGGAGACCGACGACGAGGAGGAGAGGGGCGCCGAGGAGGAGGAGCTGGAGTGCCCCTTCTGCGG
GGAGGAGTTCGACGGCGTCGGCCTGTGCTTGCACATCGAGGACGAGCACGCGGCGGAGACCAAGGCCGGGGGCAGGTGGAGGAACCAGCGAGTTTCATCT
GGATCACCTTCTTCAATGTATTCCGCATTGAAAAAGGATGCGGCGCACATACAATACCGCTATGGTGGATCCTCTCGTGCCACCTCGCTCAACACAGTGC
CTGATCCTCTACTCTCCTCCTTTGTCGGTAGCTTCATTGATGATGATGCAGATTCACCAAAAGATGCACAAGAAGAGTTATTGGAAAAAGTTATTGAGAA
AAGTGATCCCTCGGAGCAGAAAGCAGAAGAAAGTGCTGAGGAGCCTTTGCTCCCTGAGGAGAAGGAGGAGAGAACCAAGAGGAGCCAGTTTGTGCAGGGG
CTGGTGCTGTCCCTGATGTTTGATGACATCTTGTGAAGAATGTCTTGTTCCGAAAATTGATTGAGAAGGCAGCTCTTGCTTCGCCAGACAGTTGTATACC
TTAGCGCAAGTTGCTACCTTTCACCCAGTTGCCATTAAAAACAGATGGCGGCTTTGTTGTGCGATGTTAAGAAGGATGAATGTTGTGAATATGGATGTTG
GTTAGTATGCGCGTCGGTTGGTGTCGCATGAACAATAAGATAGTATATATAGGTCTGGTAATTTGATGAGATGTTGTCGGGGGGCTCCCGCGGGCGGCCC
TGGTTGTATGTATGATTGGGTGGCCTAGTGACTGCTGAAATAATTCATCCTATTTATTTTCGGAAAAAAAAAA
page-top