Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14981  (registered. 2007)
Contig Information
Length 266 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit GJ16328 [Drosophila virilis] >gi|194141048|gb|EDW57472.1| GJ16328 [Drosophila virilis]
Score 77
Evalue 3.54937
Total Hit Count 2
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14981
CTCCTAGTAGTCTTCCTCTTACTTATTATGATCATCCATCATTCTGCGTGTGCCCATATTATATACTCCGTATATAATGTCACATATGTGCGTGCGTGCA
TGGCCGGTGCGTGCCATTCAGCGAATAAATGTATAAATAAAATGGAAGTGTAATTTCTACGGTTATGTGGAGTGCAACTCTGTTTTATTTTCTTATCTTT
TTATGCCATGAATATTGCTACATCTATGGAAAATTTCTTACGCACAGAATTCCCTGAAAAAAAAAA
page-top