Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14866  (registered. 2007)
Contig Information
Length 1587 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_OKCS Seed DPA5 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0595800 [Oryza sativa (japonica cultivar-group)] >gi|20521316|dbj|BAB91830.1| putative ribosomal RNA apurinic site specific lyase [Oryza sativa Japonica Group] >gi|20804636|dbj|BAB92326.1| putative ribosomal RNA apurinic site specific lyase [Oryza sativa Japonica Group] >gi|113533003|dbj|BAF05386.1| Os01g0595800 [Oryza sativa (japonica cultivar-group)]
Score 1426
Evalue 1.22966e-155
Total Hit Count 176
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14866
AGCCGCGCACCGCAGCGATCTCCCCGCGCTGGCGCCGCCTACGGCCATCGACGCCTCTTGTCCTCGACGACACCGACATCTTCGATGACTTCGCCGAAGC
CGACGACGACGACGACGGCGACACCTTTGGCCTCATCGACTGGCGCGCCCTCACCAATACCCTCTCCCGCATCCTCTCCGGCCACCCGGGACCCTTCCGC
TGCGTCCACCTCACCACGGCTTGCAACTACGCGTCCGCTCGCGGCGGCAGTGCGCTCGTCCGCTGGCTCCACCTCTTCGCCGCCAAGTCCATCCAGGAGC
TCGTCCTCATCAACTTCCCCAACTGGCCCTTCAAGAACACCCTCCCTGCGGAGATCCTCCGCGTCGCCTCCCTCCGCCGCCTGTACCTCGGCCTCTGGGA
CAAGTTCCCGGACACAAATGACCTTCCCAGCGGCGCCCACGTCTTCCCGCACCTCGCCGAGCTCGGCTTCTGCAAAACCGACATCAAGACCAAGGACCTG
GACCGCCTACTTCAGTGCAGCCCCGTCCTGGAGAAGCTCGCGCTCATCCTCTGCTACGACACGCCGCGCAACGTCCGCGTCCGCAGCCGCAGCATCCGCT
GTGTGCTCTTCTGGATGTCCCTCGCGGACGCGCTAGCCGTGGTCGTCGCCCCGTGTCTCGAGCGCCTCATCCTGTGGAACGACTGCCCTGGTGCCTGGCT
CGGCAAGGACTTTCGCACCAGAGTCAAGATTGGCTACGCGCCGGAGCTCAAGGTGCTCGGCTACTTGGAGCCAAGCTTTCATGTGCTCGAGATCGGCAAC
ACCGTCATCGAGTTTGGCACAAGGCCCAGCCCCACGACCACCATTCCAAGTCTCAAGATCCTGGCGTTAAGGGTGCGATTTGGAGTGCGCAAAGAGGCTA
AGGTGCTGCCTACCTTCCTCAGATGCTTCCCCAATGTCGAAACATTGCATGTCATGTCTGCTGAAGCTGATGAGCCCACTGGCAAGCTGAATTTCAAGTT
CTGGCATGATGTCGGACCCATCGAATGCCTGCAGTCACACACCAAGAAGGTGGTGTTCAAGAACTTCCGAGGGAACCGGAGCGAGGTCGTGTTCCTCAGG
TTCGTCGTGGAGAGAGCACAGCTTCTGCAAAAAATGGTGGTCGTGTTGGCAGATGGAGACCCTGCTTCAGAGGAGAGGGTGGCGGCCAAGCTGAAAACTT
TGGCTTGCAGCACCAAGCGTGCCAGCAGAGACTCGAAATTCTCAATCTTGGTGCGCAGCAGTGGGGGCAGTGATTGGAGCTTCCGCGCAGCGTCCAATCT
CTCCAAGAGTGACCCATTTGATAGCTGAAGCTGATCAAGGTGCTATCTGTAGCTGATATGTTTCGATCGTGATACATCATTGCCATTTCTTTTGCTAAGC
TAGCAACATACTTTGCTTGTTTGAGTATCGCCTATCCGCTGGCAAGAGCGCTTATTTAGACTATGAATTCTTGGCTTATGTTTTGTCTTGATGGTAGTAG
AGTTTTCTGGTCCAGCAGCTAGATGGTCAGTAGTCCATGCAATGTCTGGTCCTGCTGAATTGTACCCAAGCTGGCTAAATTGCAGAC
page-top