Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14839  (registered. 2007)
Contig Information
Length 915 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195605920|gb|ACG24790.1| peroxiredoxin-5 [Zea mays]
Score 834
Evalue 2.4564e-87
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14839
GGCTCTGAGCAGGCAGCTCCCAGCCGTGCGCCGTCTCAACTCTCAAGCGCCGCTCGCCAGCGAAACCCGATCCAAGGACAACAATACCTACTCCCAACCT
TCTGTGGCGATGGCTTCAGCACTGGCGAGGAGGGCGGGAGGTTCCCCTGCGGCGGCGCTGTGGGCCGCGGCCAGGGGGTTCGCGTCGGTGGGCTCCGACA
TCGTCTCCGCGGCGCCCGGCGTGTCGCTGCAGAAGGCGCGGTCCTGGGACGAGGGAGTCGCCACCAAGTTCTCCACCACCCCTCTCAAGGACATCTTCCA
TGGGAAGAAAGTCGTCATCTTCGGGTTGCCGGGCGCATACACAGGAGTATGTTCGCAGTCACATGTCCCTAGTTACAAGAACAACATTGATAAGTTGAAA
GCAAAAGGGATCGACTCTGTTATCTGTGTAGCTGTAAATGATCCCTATGTGCTGAATGGATGGGCAGAAAAATTACAGGCAAAAGATGCAATTGAGTTTT
ATGGCGACCTTGACGGGAGCTTCCACAAAAGCTTGGATCTGGAAATAGATCTCTCTGCTGCTTTGCTTGGCCGCCGCTCCCACAGGTGGTCAGCCTTTGT
CGACGATGGGAAGATCAAGGCTTTCAACGTTGAGAAAGCCCCTTCCGACTTCAAGGTTTCTGGTGCTGAGGTTATCTTGGATCAAATCTGAGCTAATCGG
TGCTCTGTTTTGCTTTTGTGAAGCGAATAAGTGACAGCTCGAGAATCTGTGTGAAGATGTTGCTGTCTGTCGTGCTAGTTCCAGAACAGTCATTTTGCTG
CTGCAAATCTTTCTTTCTTTTGTTCCAGAACAGTCATCGAATTAGTCACCGGTTCGTGTATGCGACAGTTTCTGTTATTCACGTTTGATGAAGAGGTGTG
TTCGCGTGCAGGTAA
page-top