Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14768  (registered. 2007)
Contig Information
Length 1378 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Serine/threonine-protein kinase SAPK2; AltName: Full=Osmotic stress/abscisic acid-activated protein kinase 2 >gi|218200043|gb|EEC82470.1| hypothetical protein OsI_26911 [Oryza sativa Indica Group]
Score 755
Evalue 3.85096e-150
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14768
TTTTTTTTTTCCAAAAAAAAACATGTAGACTTATCTTACACTGTTTACACAGCAAGGCCAATCTGTGGGCTACAGAGAATTTGTGATCCAGAACAAAATC
TAAATGGAAGCATGACAAACAGGAACACATCCACACGTAAACCATCAAGAGAACTTTCGAACCACTCATGAGCGTCACAACGGGCACACGAAATCCCCGC
TGCTCTCAACATCAATGTCGTCGATATCGAAATCGATGTCGTCTAGATCCATGCTCCCCAGGCAGGCAACCTGCCCGGCAATCCCTAGGGCGTTATCGCC
AGGTTTCTGCGCCTCCTGGATGATCGCCATGGCTTCTTCCAGACTCTGTGACGGCGTGTTCATGTCTGCCAGATGCATGCTCCTTTGGTACTCATCGGTC
ATCTCAACGGGCAATCTCTTGAGGAACCATGGATGGTTCTTGATCTCCGGGATGGTTATTCGCTGCTGAGGATTTCCAACGAAGATGCGGGACAACAGAT
GTATGCAATCCATCGAGACTCGAACGTAGTCCGGAACGGAGTACTGTACGCTGAGTATCCTGGTGATAGTTTTGCGGAAGTTCCTTGGCTCATCAGGGTC
CTCGAAAGGATATGCCCCCACAAGCATCACATAGAGCGTTACTCCACAAGACCAAACATCGGCGACCTAAGATTATAGGAGCTGGCATCTGAATGCTTCA
CATCACATGGGGTACTTAAACCATTAAAACCATGCCCTAGTGGTGAAAATTCATACCTTTCCATCATACTCTCTTCTAGAGAGGACCTCCGGGGCGATGT
ATGCCGGCGTGCCGACAGTTGACTTCGGTTGAGAGTGCAAGACAGAAGACTTGGAGTAACCGGAAGTCACAAAATCTTGAGTCGAGGTGCGACACTACCA
TCCAATAGAGTGTTTTCTAGTTTCAAATCTCTATGACATACTTGCATAGAGTGACAATAGCTCACTCCAGAAATCAATTGTTGGAAGAAGAATCTTCCCT
CATCCTCGCTAAATCTCCCTGCGTTGCAAATCCTTTGAAATAGCTCGCCGCCAGAGGCATATTCCATAACTATTGCCAAATGTGTCTGAGTTAGCACGAC
CTCCTTGAATCGAATAATATTTGGATGCTTCAGTGACCGGTGGTTCATAATCTCCCTTTGAACATGTTCATCAATCTTGTGGCCTCGCTCGATGAACTTG
ACGGCGAAGTGCTCCTTGGTCCTGACGTCCCGCACCAGCTTGGCCACCCCGAAGTTGCCGGACCCGATGTCCCTCACCACCTCGTACCGATCCATCCTCC
CCTCTTTCTCCTGATCGCTCCAGCGCTCCCCTGAGAAGAAGCACCTTGTGAAGGAGGAGGAAGCAAGACAGGAGGGTG
page-top