Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10991  (registered. 2012)
Contig Information
Length 648 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig10991
AAAATGGCTAGAGCGAGCATCGCCAACAGCAGGGATAAGGGCTGGCAGTAACAGCCATCATTGGGCTCAGCTCACTGCAACTGCACCCAAGTTGCGGTCC
CAGGCTTCTGAAAAGAAGCTGCACAGCACAGTTAAAATACTTATTGAACTGCGTAACACCTTAAGCAGATCCAGAGCTCCTCCAATGGGTGCCATCTTTG
ATGCTCCTACTCAACACCACAAATTAGAGTCTTGCCATTCGCATCTTATGTTTTCATCAGGTCAACCCAGTAGGTCAACTAGGCTGAAGGAGTCTGGGAT
TGCAACTCTTCTGCATCATTGTTGTCATTGTTTTCAGCTGCATCTGCAGGTTTCTCAACATCACAAGCAGCAACGGGTTCCTTATCCTCACCCGTGCTCC
TCACTAGTCTCTTTGATCTTTTAGGCCTCAGAGAAGCAATATGCTCCTCATCTTCGACAGGACCACTCTCGGGAACAACACCATCCGCACCATTATTATC
CTGTGACTTTGGAGGTTTCTTGTGCGAGCCCTTTTTCTTTTTGCTGGTTGTATTATCTTGTTCTACAGGTTCTTCAGTTGGATCATCCAAGTCTTCAAGC
TTCAAATCTCCTTCTTTGTCAACCTTGATGGCCTTTGCTCGCCTCTTC
page-top