Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14520  (registered. 2007)
Contig Information
Length 590 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_SHDr Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 317
Evalue 8.9982e-28
Total Hit Count 10
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14520
TGATCACACCTCCAGTACTCCTCCTCAAGATCGCAGCATGCAATGGCCTCCCTTACCACCACCGCCGCCGCTCCACATCTCTCCCAAGCCTTGAGACGAC
GGCGCAACGCCGCCGTCCCTAGGCGAAGACCCTCCTTCCGCTGCCAAAACCGCCTTCCCACCGAGCCGCCGATCGGCGGCGACGGAGGAGGCGGAGGAGG
AAAGAAGAGGGCGTGGTGGGTGAGCATGGCCGAGAGGGCGCACAGCGGCGTGGTGAAGGCCGGGATGGACGTGCGGGAGAGCCTGAGCCCGAAGCAGAAG
GGGGACTGGAAGGACGTGGCGCTCATGAGCCTCTCCTTCGCCGTCTACGTCTACATCTCCCAGAAGATCGTGTGCACATACTGCGCCTGGGTCTCCATGA
TCAATCACTAGCTCAAATTCCTAGATGTATAGTCGCATATTTAGCGCCAACAAAGCATCTGCTGTTATCATTGTGCTTGTAGTTCATCACTCTAGATGAT
CTAAGAAACTTGTTCTCGTGCAAGACATGATTCTGAGTTCAAAAGTTGCGTACCATCAGATCTGGAAGAAGCAGCAAACAAAATGCCAAT
page-top