Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10958  (registered. 2012)
Contig Information
Length 1984 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_VSCB Liquid cultured tissue 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|39726027|gb|AAR29963.1|| putative cellulose synthase catalytic subunit [Hordeum vulgare]
Score 748
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10958
ATCCCAGAACAATAGACGTTGGTAAAGAATCAGGTGCCTGCGCTACTATTTCCCCATCTTCACTCACCGAAATTCCCATTTCACCAAGCTCACAAGCTGT
GATCGAAAAATAATCGCCGCATCTGCAGGCGTACAATAGCTCCACACCATCGTCAGAACTTTCAACAGTCATATCCTCGATTTCGATATCAGATGCGATA
ATATCAATGCTCTGTCTGGATGATTGAAGCTGTTTATCATACTCTGCTCGACATTTGGGGTAGCGTAGGGTTTCCCATGCCTTCTGCACACCGAAAAAAC
CATGTTGCTCGCCGGTACACACAGATGACTCGACAGTCGCCTGTGCTTTGTCAGGATGTGTGTTTAAAGCAGCACACTTGTATGCTGCACGTATTTCGTC
ATATGTAGCATCTTCAGGCACAGATAGAACTTCATACAAGGTCTTCTGGTTGGAGATGCCGCTGCCTTGAAGCATTTGCAGAAGCTGGAGAAGTAAAAAA
GGGGCCTCAGAGAAACAAATAAATAGAGAAAAGCATGCAATTAACCCTAACCACTTCATGACAAAACAATTGCTAGACAAAGCAGAATAATACTTAAAAA
ATGAAGCAGAATAATACTTGCTATATAGTACTTCCTCCGTCCCAAAATAAGTGTCTTAACTTTGTACTAACTTTAGTACAAAGTTGAACTAAGCTTGAGA
CACTTATTTTGGGACGGAGGGAGTACTTCATATTAACACTAAGTACCGAGTTTTTACAACCAAGGTCATCTGATAAACTAGTGTCACCCGCTAATATCAT
ACAACAGAATGGGTGACAATTCTGTTCCAATTATCTTGCACTCTCCTAGCAGTTGATGCCACACATTTGGATATCTGGCCCAGTGACTCTTGTTGTGAAC
GGGTCAATGCGAACCCACAGCAAGGAGAAAATGGATGCAAGAAGGATGGCCCAGACGACAACGATGGTCGGCGTGCGGTTCTGCCGTCCCATGAGCCCCT
TGAGGAATGGGTACAAGTGGATAATCACCCAGAAGGCAAAGAAGAGCTTCCCGAAAAGTGGGCCCCATGACTGATAGCCGCTGTTGATCGCGTAGGAGGT
ACCAGCCACAACTCCGACAAGGTTGATGATCAAGATAGTTGTTGGTGGGATCAGAAGAGTCGTCCACTTGAACATGTAGAGCTCGGCAAAATCATTATCT
TCATCGGATGCTTTTGAAGTGACAGTGAAGCTGGTGTCGATACCAGCAAGTACCTTCAGAAGACCTTGGAAGACAGCAAATAGATGTGCAGAAATGCCTC
CGATGACCCAGAACTGTTCATTCCTCCACCACTCGTCGATGCCAACACCACTCCACCTCATCTCAAGGATACCAGTGGCGAAGATTGAAATAAAGAGAGA
GATAAACCATATACTGGCAATGTTGCTAATCTGTGGGATGATAAACTTTCCCGTGAGAAGACAAACAGCTGGTAATATGCAGTATATGAGGAGTGGTATT
GATGTGAGTGGATAGATAGTGGTGTTGATGTAAGCAAATCTCTCCAGGAATTTAAGCCGTCCGCCATAGCCATACCATATGGGACAATGCCTACTGAAAA
GAATTTCCACCGAACCAAGCGCCCACCGAAGCACTTGGTTCAGACGATCCGAAAGGTTGATGGGGGCAGACCCCTTGAAAGCTGGTCGCTTAGGCATGCA
GTAGATTGACCGCCAGCCGCGTGCATGCATCTTGAACCCGGTAAGAATATCTTCTGTAACAGAACCATAGATCCAACCAATCTCCCTTCCCCAATCACTT
CTGTCCTCATAACCACAGCTGATGACATGGATTGCTTCTTTCAGAAGAGACTCTGGAGTTGCAGACTGGGGAACACCACCGTACTCCATTAGAGTGGAGG
CTACGAAAACACTGGACTGGCCAAATCTCTTCTCCAGGCTCNNNNNNACATAAGAAGTGATTTCTCGTCGTCAAATCCAGAACC
page-top