Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14430  (registered. 2007)
Contig Information
Length 688 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit germin-like protein 1a [Hordeum vulgare subsp. vulgare]
Score 589
Evalue 7.052e-76
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14430
TTTTTTTTTTGCGAGGCTAACTTATTCAATCGTATTACAACTGCATGCGAGCTTAACCAGAAGCTTGAATATACAAGTCGGATTATGTATTAGTATTAAA
TTTCGCTAGCATAGCATGCAGATCGGATTATGTATTGATCATCTTGGGCAGGCTCTTAGGAGGCCTGGAAAGACCCACCAGCGAACCTGGACTTGAGAAG
TTCGACCACCCCGGCGTCCACCCGGAGAGCCCTAGTGAGCACCGGCGTGGGGATGGGCGGGTTGGAGCCGAAGAGCGTGAGCGGCACGAAGACGATGCCG
GGGTTCTGGCTGTTGAAGGAGACGAACATGGTGGCCTCGGTGTCGCCGGCGTTGAACTGGAAGTGCATGAGGCCATGCGGGATGAGGAAGTTCTCCCCGG
CGCGCACCACCCTGGAGTAGAGCCTGTTCCCGGACTCGTTGCTGCCGATGATCCCCACGAGGAGCTCGCCTTTCATCACGAGGCCGATCTCGGTGGCGCG
CGGGTGGATGTGCGGCGGGTTGGTGCCCCCGGGCGCGAAGTCCACGCGGTTTCATGGAGATGCCCTGCGTGTTCTCGCCGGGGAACTCCGTCACGTCCAG
CCTCGTCACGGCCGAGCCGTTCGGGGTGGACGTGTTGCCGCCCTTGGCTAGCTTGGAGGAGAAGAGGAAGTCGTCGCCGGCTTCCGAC
page-top