Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1095  (registered. 2012)
Contig Information
Length 588 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 4
Wh_yd Spikelet at late flowering 2
Wh_SH - 1
Wh_EMI Dormant seed with water absorption after breaking 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XA Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|291410763|ref|XP_002721657.1|| PREDICTED: histone cluster 1, H2ag-like [Oryctolagus cuniculus]"
Score 209
Evalue 1.00E-52
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1095
GCACGAGGCACCACCAGACCAGCAGCGCACACACACACACCAGCCAAGCCAAGGGAAGGTCGCCGGAGAGAGAAGCGCCAGAGATGTCCGGCCGCGGCAA
GGGAGGGAAGGGGCTGGGCAAGGGCGGCGCCAAGCGCCACCGGAAGGTGCTGCGCGACAACATCCAGGGCATCACCAAGCCGGCCATCCGGCGGCTGGCG
CGGCGGGGCGGCGTGAAGCGCATCTCGGGGCTCATCTACGAGGAGACCCGCGGCGTGCTCAAGATCTTCCTGGAGAACGTCATCCGCGACGCCGTCACCT
ACACCGAGCATGCCCGCCGCAAGACCGTCACCGCCATGGACGTCGTCTACGCGCTCAAGCGCCAGGGCCGCACCCTCTACGGCTTCGGCGGCTAGGCCGC
GCCGGTCAACTCGAATTCACCTTGTGCCGCCAGCCAGATTCGTAGCATAGCTAGCTATGGCTGTCCAGTGTTCATTGTCTTCAGTGTAATGGCCGCATCT
CGCCGTTCTTGTTCAGTGTTCAGCGTTCAGTGTTTGGATGCCATACGATAGAATGGAAATCGCAGCATTTTACCCTCGAAAAAAAAAA
page-top